

>tg0018 UDP-glucose 4-epimerase (galE)

>tg0018 UDP-glucose 4-epimerase (galE)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 22026 - 23973 (Additional range around tg0018 is :500nt.)

>Thermococcus gammatolerans EJ3 GCTCGAGGTCGCCAACATCGTAGACGGCTATGAGAGTTTCACCCGAATAGCGCGCGAGAAAGTCCTGGAGCGAGAACGAG AAGAGGTTGTCGCCAGCTATGACGAGGTAATCATCCAAACCGAGCTCCTCAACGGCCTTCTTCATAGCACCTATGGTTCC GAGCTTCTCCTCCTCGTGGAGGGTGTCCTCAACGATTAGCTCGACGCCGTATTTCTCTGCAACCGGTCTGAAGTGGGACT CGAAGAAGCGGTTCGTGGAGATGTAAACCGGCAGCTCGAGCTTTAGGGCCTTTTCAAGGATGTAATCTATTATCCTCCTT TCTCCAACGGGGAGCAGGGCCTTTGGGTTGTCCTTTGTAATGGGCCATAATCGAGTTGCGTAACCGCCAGCCATGATTAA GACCTTCATCGTCCGTATCACCCCAACCACTTCAGGCATCTCAACACAAAAACTTTCCCAAAGCTTAATAACTGTTCCTT GAACTCCCAATGGTGGTACC atgaaggttctagtcacgggcggagctgggttcataggttcgcacctcgtggacaggct catggagctcggacatgaggtgagggttctcgacgacctcagcgctggaaccttggacaacctaaggcggtgggtcgatc acgagcgcttcgagttcataaagggcgacatgagggatcccaaaatcgttgaagaagccgttaaagacgttgaagtagtc ttccatctcgccgccaacccggaggtaagaataggctcccagagtcccgaactgctctacgagaccaacgttctcataac ctacaacctcctcaacgcgatgagaggctcaaacgtagaatacctcgtcttcacgagctcatcaacggtttacggtgatg cagatgtcataccaaccccagaggactacggcccgctcgaaccgataagcgtctacggaggggcgaagctcgcggccgag gccctgataagcggctacgcccacacctttgaattcagggctttaatcttccgcctggcgaacataataggcgagcgctc gaaccacggcgtcatctacgacttcatcaacaaactgaggaagaatccagaggagctagagatactcggtgatgggactc agaggaagagctacctccacgtgagcgacaccgttgagggaatgctccacatcttcgagcacttcaagaggtccgaaaag accgtcgatttttacaacctcggcaacgatgactggataaccgtgaaggagatagcggagatagtgagcgaggagatgag ccttaggccaaggttcgtcttcaccggtggcgtcgacggtggcaggggctggaagggggacgtcaagttcatgcgcctga gcatagagaaggcgaaggccaccggctggaggccaaggctcaacagctacgatgccgtgaggagaaccgtgagggaactg ctgaagagc TGACGGACTTTAGAATTTTTGCCATTTTTGCCGAGTTCTTCTCATTCCTACGGGTTCAGGATTAACGTTT ATAAAGCGGGGCCGGTATTTAGGTTAGCGGAAGGTGTGGACTATGGTCAGCACGCTCATCATCGTCATAGCCGGCATAAT GGCCTTCTGGGTGCTCGTCTATGCGGCCTTTGGTAGGAGAGAGGAAGAGAACGAGGAAGAGGGAATAGCCGTTGATCTGT TCGTGATAATGTGGAGAACGAAGAGGGTCTTAGGCTTCATAGACAGGCTCGCCTCGCGGGGGAGAAAGTTCTGGAAGGTT TACGGCGACGTTGGGATAGCCCTTGGGTTCCTGGGCATGGCCTTCGTTTTCTACGCCCTGCTTAAAACAGCCATCGCCAC GATCCAGACCCACGGGAAGCAGGCTGGGGTTCAGCTCGTCATTCCTGGACTGACTATCCCCCTCTGGTACGGCCTTGTAG GACTTGCCGTTGTCATGGTCGTCCACGAG