

>tg0035 membrane bound hydrogenase, MbhM subunit (MbhM)

>tg0035 membrane bound hydrogenase, MbhM subunit (MbhM)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 34822 - 36802 (Additional range around tg0035 is :500nt.)

>Thermococcus gammatolerans EJ3 TGGCGGTGAGGATAGGCGAGCTGTGGCAGAGTTTAGAGCTTATCGAGCACGCCCTCGATGGGATGCCCGACGGTAAGATA AAGGCCTTCCCCAAGGACAACGTCCTCTACGCGAAGCTTCGCCTTATGGTTGACGGCGAGGGAATAGGCAGGTATGAGGC GCCGAGGGGCGAGCTGGTGCACTACGTCCGCGGAAAGAAGGGAAGCGACAAGCCCCTCCGCTGGAAGCCGAGGGAGCCGA CGTTTCCGAACCTGTTCGCGGTCGCTGAGGGCGTCAAGGGCGACCAGGTGGCCGACTTCGTCGTTGCTGTCGCCTCGATA GACCCATGCCTGAGCTGTACGGACAGGGTTGCGGTGGTCGAGAACGGAAGGAAGAGGATCCTGACCGAGAAGGACCTCAT CAGGGCCTCGATAAAGAAAACGCGCGAGATCAATCCAGATGTGAAGGGCGACCCGACCCCCGTTGGACTTGGCTGTTCGA GGTGATGCTCATGGACGTG atggggagcatagtttacccgattgcgggcctgctcgggctctacggcttcgtttcgctc gcctcgctcctctgggagggaatagacaggaagttagtggcaaggatgcagaggcgcgtcggaccgccaatcgttcagcc cttctacgacttcctcaagctagcgagcaaggaaaccatagtgcccaaaacagccaactacatgttcagggcggctccag ttcttgccctggcaacggcgatagcgctcctggcttacacgccgatgggcttcaccccgattttggccagcaagggcgac gtcatcgttttcatataccttctcacgctgatatgcttcttcaaggtggtgggagcgataagctcgggcaacccctacgc gaaaatcggagcggcgagggaagcggccatactggtgtcaagggaacctgccatgatgcttgctatctttgcaataatgt ggcgcctcggaaagctgggcgttgacaagcccttcagcatgggggtcttctaccagcacaacatctgggagataggaact ccaatgagcttcgttggggcggtaatactcctctacgtcttctccgtgtggctggcgagcgagatggaggtcgggttctt caacataccggatgcggaggaggagatagctgagggtctgctcgtcgagtacagcgggaggtatctggcactgctcaagc tgacgaaggccctcaagacctttatagcggcttccctcgtcgtggctatattcttcccctgggggatagccgactacttc aacctcgctggcctctcagcagatatcgtcaacctgctcttccacacgctcaaggtcttcatcctgctcttcatcgtcgg aagcgtcttcagggccgtgacaggaaggctgaaggtaacccaggccgttgacttcctgtggaagaacgtcttcttagcct cgctcgtgggctcgctcctcatagcgatggaggtgataatg TGAAGGCGCCGATACTCGTCCCAACAGTGCTCAAGAAC TTAACCAAAAAGCCGGCGACCAATCTCTTTCCGAAGACGGAGCCAGTGCCAGTTCCGGAGGACTTCAGGGGAATGATAAC GTACGACGTCGACAAATGCGTCGGCTGCAGGATGTGCTACAACGTCTGCCCTGCTGGAGTCTTCGTCTGTCTCCCTGAGA TAAGGAAGGTCGCCCTCTGGACGGCCCGCTGTATCTACTGCGGACAGTGCGTTGACGTCTGCCCGACTGGAGCCTTAAAG CTGAGCAGGGACTTCCTGCTGGCGAGCTACGACAACCACGACGAGAGGTTCATCCCCCTCAAGTCGGAGAAGGTCGAGGA GATCAAGAAGAAGCTTGAGGAGCAGAAGAAGGCTAAGGAAAAGGCCAAAGGTGAGAAAAAAGCCGAAAAGAAAGCCTAGC TACTTTCCTTTTCACACTCCTTTTCCACGTCAAGCTCGACACCCATTTTGTTTGCGAGGGCT