

>tg0040 membrane bound hydrogenase, MbhH subunit (MbhH)

>tg0040 membrane bound hydrogenase, MbhH subunit (MbhH)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 38700 - 41244 (Additional range around tg0040 is :500nt.)

>Thermococcus gammatolerans EJ3 AACGGCCCGTTCTTCAACGGAAAGCCCGGAACGCTCCTCTCGGCAGGGTTCCTGCCCATAATGAACCTTGCCGTCGGCCT TAAGGTCTTCACAGGTCTCGTGAGCGCGCTCGTTGCCATAGCCATGTACCGGAGGTGGAGGTCATGATTCAGTTTCAATT CATAACGGCCTTCCTTCTCATAGTCCTCGGGATATATGCCTTCTTAGCCAAAAGAAACCTCATCAAGCTGATTCTTGCTC TGGACATCATAGATTCTGGCATTCATTTGCTCCTGATCAGCCTCGGCTACCGCATAGAGCTGAACGAGGTTCCGACGGCG CCAATTTACACAGGCTATGAGACCCTGAAGAGCCCGATGGTGGGGCCACTTCCGCAGGCTCTGGTCCTCACGAGCATAGT CATCGGCGTCTGCGTCCTCTCGCTGGCAATGGCCCTGACGATAAACGCCTATCGCCACTACGGAACCCTTGACGTGAGAG CTCTGAGGAGGTTGAGGGG atgaacggggaagcaatcctgccctacctcataatcatcccgctcttcggagcgttctcg atgccgatagtgagcctcatcggcaggaaggcgagggaagcctgggccgtaataatcagcggtgctacattggctgtcgc ctcggcgctcttctactctgtctgggaggacaaggggataatcgtctacaccctcggagccaagagcccgctcggccagg gcgtcagcttcccgataaggatagtctgggaggtagacctcctcggcgcgataatggtgctcatggtggccctcgttagc ttcctcgcggtggtttactcgctcggctacatgaagcacgacactggcttggacaagtactacaccctcatcctaatcct cgagctcggaatgctcggcatagcgataaccggtgacctcttcaacttctacgtcttcctcgaaatcatgagcatagcga gctacgcgctggtagcgttcaggaacgacacatgggagggcattgaagccggcatcaagtacatgttcgtcggctcgata gcgagctcgctcgtcctgctcggcatagccctcctctacggccagtacgggacgctgacgatgggatatatggcaattaa gatcattgagaacccgacggttactgcaaaggtcgctttagctctcttcatagcggggctcctcttcaagagcggtgctt caccagttcacatgtggctggcagatgcccacccggccgcgccgagctcaataagcgccatgctctccggactggtcatc aaggtcggaggggtctacgccctggcgaggatactcctcagcatctacggcgcgagcgtcagcgtcaagacagtcggctg ggtcatcataatcttcgcctgcctgactctgataataggcaacgcgatggcagtagtccagacagacatgaagagactct tggcttactcctcggtgggacagataggctacatcctcctcggcctcggaatcggcttagcggcctacggaagccacact ggcgaggtggcccttgcaggagcgatttaccacaccttcaaccacgcactcatgaaggcgctcctcttcctgattgcagg agtcgtaatccacgagctcggcacgagggacctgaacgagctgagcggtttagctaagacaatgccgaaaacaaccttcg ccttcctcataggagcggccgcaatagtgggaatgccacccctcaacggcttcgcgagcaagtggctcatctacgagagc tcggccatattcaacccgatactcggcgcgatagcgataatcggaacggcattctgtacggcagcatacgtcagggttct ctacaccttcttcggaaggcccagcgagagggtcatgaaggccagagaccccgaggcgagcatgctctggccgataataa tcctcgcggtcgcgatagtcatcatggggctcttcccctggcagataagcgagaagatcatgcttccagcggtcaaagcc cttgaggaccagctggcctacataagcgctgtcttaggaggtgcg TGAAATGTTCGGCTACTGGGATGCGCTCTACTTC GTCCTCGTTTTCATCGTCGGACTCATCCTGGCTTACCTCCTCGACAAGTGGGCGAAGAGGAGCGGAATGGGGACGAGGGA AGTTGGCGACGGGACGAAGATATTCATCAGCGGTGAGGACCCCGAGAAGGTTATTCCGGGCTTCGAGCACTTTGAGGGCA GCTACACCGGCAGGAACGTCATGTGGGGACTAACATACGCGCTCAAGCGCTTCTTCACGGCCCTCAGAGGGGAGCACACA GGACTGCTCACGGATTACGTGAGCTACCTGATAATAACGACCGCCTTCGTGATGGTGGTATTGCTCATCTGGGGGTGAGA TGGAATGGCGATAACAGTTCCCGCCAACAACGGTTCAAACTCATCGGAGCGCGAGAGGCTTGAAAAGAGAATCGCCCAGC TGTGCCGCTACATAGGGAGGTCGCCCTGGGTCTTCCACGTGAACACCGGCTCGTGCAACGGCTGCG