

>tg0059 formate hydrogenlyase II subunit F (Mhy2F)

>tg0059 formate hydrogenlyase II subunit F (Mhy2F)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 49607 - 52340 (Additional range around tg0059 is :500nt.)

>Thermococcus gammatolerans EJ3 AGCCCGTCCTCGGCCTCGCGATAGGAACCTTAACCCTAAACGCCCACACCCTCAGGATTGGAGCCATACCGTTCGCAGTA ACTTTTACGCTCTCGGTTCTCCTCGCGTACGGCCTGCTGGCTTACTCGGTTTACGTCGAGGGAGGCTTCATACCCTTTGA CGTGGCGGAGGCGGAGCAGGAGATACTCGAGGGTGTTTTCTCGGAGTACAGCGGTTACCTGCTCGGGATATTCAAGTGGG CGCTCATGATAAAGCGCTTCGCCCTGCTGTGGCTCCTCAGCAGTTTCATCTCGATACCTCTCGTGAGGAACATCGCGAAT GGTGCTCTCGGCGGGGCCTTAATCCTGGTCACCCAGCTGATAGTTCTCTTCCTGCTCTATACGGCCGTGGCGATAATTGA ATCCATGAACGCGAGGCTCAGGATAGAGCAAATCATCAGGCAGAACGCGGGGGTGTTTGTCTGCTCCATAGCGGTCCTCG TCCTCGCGGCTCTGGGGTG gtgaatatgaaggaatgggcgcgtaagattaccgatgaaaaggttcgggagaggtacgtt aacgaggtcatcgagaggttcagggataggattattcgcatcgagaggaacgctgacaaccaatggataatcgagattcg gaaggaagaccttcccgaggtcataggctacataataaaccaccccgagtggaaggagacccagctgtccacgatggtcg gggccgacgagaggcccctgcggggcaagttcagcctgatctactggatatcgataaacggggcgagcggggatgtcgtc tttggcataaagacatacatctcggaggacgacccaaagttcccctcggtcacaccgattcacccgggcgccaactggta cgagagagaggtaaaagacctgctcggcctcatcccggagggccatccggacccgaggcgcttggttctcccggatgact ggccagaaggagtctatcccctcaggaaggacttccactacaccgacagcccgaagagagagtttaccgacgagaccaag tatccctacagggagccacccaagggaaccgccgtcttcccgctcgggccctaccacgttgcgctcgacgagccgggcca cttcaggctctatgtcaagggggaggagatagttgacgttgactacaggctgttctaccagcacaggggaatagagaaga taggcgagaacaggctgacctacgaccaggtcaatttcatagccgagagaatatgcggaatctgcggcacggcccacgcc ctcgcctacgctcaggccgttgaagcggcggggggtgtggaagtccccgagagggccgagtacatcaggaccgtcatggc ggagatagagaggctccacagccacctcctcaacctcggtttggcctgccacgacgttggcttcgacaagggcttcatgg atgcgttcaggctgagggagcacgtgatgtggctggccgagaggctcacggggaacaggaagacctacggaatggtcgtc atcggtggtgtcagaagggacttcctcgaatacaggcggagtatgattgagaaggtcatcagggagctcagggagggctt ccagaagtgggccgaccagacgctatcaaccaaaactttcgtgaagcgctgtgagggcgttggagttctctcctacaagg acgcgaagaggtggagctcggtcgggccctgggcgaggggctcgggaagggacctcgacgcgagaagggaccacccgttt gcggcctacaagtacctcgacttcaaggttccggtttacaaggagggggacgttctggcgagatgtttagtaagggcgga ggagattcttgagtccatctggataattgagcaggccctcgacgagatgccgggaggggacatcctcgcggagtggaagg agatacctccgtaccaagaagcggtaggcttcaccgaggcgccgaggggagaggacgtccactacgtcatgaccggcgag ggtaacaggctctaccgctggaggataagggcgtcaacctacaacaacttccccgctttgccggacgctatgaggggtaa cagcgtggccgatgccgttctgataatagcctccatggacccgtgctactcctgtaccgagagggttcaggtcgttgacg cgaggagcggtaaggtgagggttctcacggagaaggagctcacagaactgtcgagaaaggccagcaggggggtc TGAAA TGGCCGTCACGCTGAAGTACCCCTTCGTGAAGATTGAGGCCCCTCCCGAGTACAGGGGAGTTCCGCACATAAACCCGAGG CTCTGCATAGGCTGTGGCGCCTGCGTTAACGCCTGTCCCGCCGATGCGCTGCTGAGGATAGACGATTACGAAAAGGGAAC GAGAAAAATCGTCCTCGACGTTGGCAGGTGCATACGCTGTGCCCGCTGTGACGAGGCCTGCCCGACGGGAGCGATAAGGA TGACGAGGAACTTCGAGGTGGCAACCCTCGACAGGAAAGACCACGTCGAGGTCGTTGAGCTAAGGCTCCACAGGTGTCCC AACTGCGGAAGCTACACGGACTACACCGAGAGGGCCCTCGAAAAGGCCCTCCAGATACTCCCAGAGGGGCTCTTCGACGG GGATGAAATCAGAAAACGCGCAATCCTCTGCAGGAACTGCAGGAGGAAGCTCACAGTTGATGATGCCGTAGAGGCGAGCA GGGAGGTGGTAGAAT