

>tg0086 hypothetical protein TGAM_0086

>tg0086 hypothetical protein TGAM_0086

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 81350 - 83399 (Additional range around tg0086 is :500nt.)

>Thermococcus gammatolerans EJ3 TGTTGCCCTCGTACTCCAGATCGTTCGCAGGCAGTATCTCAAGGATAAGAGAGTTGAGCTTTCTGTCGTGGTAAGCTATG ATCTCAAGCGCGTCGCTTACCTCTCCGCTCGCCGGGATCACGTCAACGACTAAGCTCTCCCTCGGGAACAGAAGCGCCAC AACGTCCCCGCTCCTGAAGAGTGCTATCCCTTTTCCCGCGTAGAGCTCCTCAAGCCCAAGTTCCCTCAGGAATTCCCTAA CCTCGTCCCCGCCCGGGAGACGCTTTTCAGTGACCATGACGTCCCTCATCCTCTTCGCGAGAGGAACCGCGACGGTTATC GGCTCCCTCATCTTCTCCCACCGCATGTACTCCGAGGGAAAAATTTATAAACCTGCCCCGGGGATAATGGATCGGGCTAA CTGTAGGGTCCCGCGGTAGCCTAGCCTGGGAGTGGCGGCGGACTGTAGATCCGCAGGTCCCCGGTTCAAATCCGGGCCGC GGGACCACCAGAATTCTCG gtgttctcgatgggggcaatctcaaaggctatgcggcttctatcatgggttttagtactg cttctcctcggggttacccttgacgtttccctgaacgacggcgctctaaccaagaagtacctcccccgcccggttcttga tgagtttgaggggcttcgggagcgggttgcgtcccgcgctgaggactacctcgtaaccgaggcctttgagcgctacctca acgatcctaacgaactctccgtgctcaggaacatctccgttgccctcaagggagaggacgccgtgagctccgcatggaac gttcttacctgggaggacgagcacctcaattacgatcgcaacagaactgaaccgatgttcataccgccctcagagttcat ctcccggggcaggggaatatgcggcgattacgcactactgaccgcagggcttctcctggttatgaaccactccccggttt acgttctctcgatagagttcaatgattcagacgttggtcacctgaccgctgccgtatctgtaaacggccgatacctcgtt gcggatcagcacccgccccttatggatcttggggcctattaccgccactgggcgctctacgttgatgatcccgcccacat atcccgcgccaccgtctatgtgctctcctggagagggggcagaatcgttatggaaaggtacagcgagctctcctggagag attttctggcacaggactacaacatgagcgagcgggatctcaaatccatgtcggaggagctcgtaaggtcttttgaattg aggtacaacgtggttcccgatcccacgctccccagaatagcggatgaaggtgtatcggagcgctatcactgggtatccct ctggcagggcattttccctggttacgccgactactacctgcctatcacccgcgatgagatggtcgattacatgctcgatc agatggggacccagagtgagcttggcaaaaaacttcgcgagtcccgtgccttctggcttgagctctccaagagcggggtt aacctgacgctgaccctctatctggcagga TAGGGTTGATGGTTTTCCAATTTTCCGGAGAAATCTCTACACTGCTGTA CTCCTATTGGATTTCATTGTAGCATTGGAACTCTTTCCTGTATATTTCTTCTTTTTCTGAAATCTGGATTGTATATTCTC TGAGATAAAGGCCCCAACGATTAGAAAGATATTTAAACTTTAAGTTCCAATTTTTATACCGGTGGGTGTTATGGAGTTAG AGTTACTAAAAAAACTTGTATCAATTCCCTCCCGTTTTGGAGAGGAAGATAAAATTTCGAACTTCATTGGTTCGTTTCTT GAGGAACATGGGCTCTCCGTTGAGTATCAGGAGGTCGAAGGTTTTGGTAGCAACGTTATATCACGGATCAAGGGAAAGAG GCTAACCGTCGTTCTCAACGGTCACATGGATACCGTCGGCCTTGGCTCGGGCTGGACGAGAAACCCGTGGGGCGAGCTCG ACGGCGATCGTTTCTACGGCCTGGGAAGTGCTGACATGAAGGGTGGTCTCG