

>tg0105 TRP-repeat-containing protein

>tg0105 TRP-repeat-containing protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 94223 - 96308 (Additional range around tg0105 is :500nt.)

>Thermococcus gammatolerans EJ3 ATGACGTGCCAACTTAAAGATTTCCCCGGGGAGACCGTGTCTGCCGAGGCCGACGAGAAAGATGAAGCTCTCACCTCGGA GGGCCCTCTCGGCCAGTTCAAGGGGTGATATCTCCTTCTCATCCGAGGGTTTTCGGGTGGTGGCCACAACGGTTCCGAAC TGGGGAGGAAAGCCCTTCCTCGGAAAGTCGAGGAGATGGAAGCGGTTTCTTCGGGCGAGCTCGAGCAGGTAGGTTCCGCC CTCACCTATTGTGGTGTGGGACGATACCTCCTCGGCAACGTCCAGTGGCCGGCCCCGGAGCGGAAAACCGACGAGGGCAA GGTGGAAACCAAAGGCATAAGCTATGGGGCCCGCTCTCGCGATAGCCCGGAGGTGAGCCTCGTGAAGTTTTCGGGTGTCA TATGTGTTGTACAGGGCGAGAGTCAGCATCGCACCACCATGCGGAATTTCCGAGAACCCTTATAAACTGTTGTGGTGTAT ACAAGACAAGAGTGATGAGT atgagttcgtacgatgatatcctcgtgctcgcttctaagggcctcttcgaggaggccat taaggcggccggagagatagaggatccctttgaatgggccgacgcgcttctcgaaatagcgtttagggcaaaggacgtga ggagggatctggttcctcttctccttgaggagatacggagaaccctcaagaaaatcaaggatcccggggacagggcatac atttactcaaaactcgcccggttccacgcggtcacggggaacggggacgaggcaacggaagtcttcgacagggcagcaga ggagatagcgaggataaaggacgagggggagcgggcaatagccatggctgtcctggcgcagaacctggcccttacgggcc tgacggaggaggccattgagacctttaacgaggcctttgacgcggccatctcggccgagatggactacaggacgaaactt gacgtcataactgaaatagcgggcctcatcgaaaacgccggcgacagcctcgactcacgggaagctataaggttctacga gatggcctacgacatctttgacaagctcaggataagccacagggccgcagacgttgagaagaagctgaagatggccagga ccctctactatcacggcccgccggaggtcagggcagcccttctggagggcaggtacaactactccctcaagctcatagaa aaactctacaaagatccgcaggagaggtttatagcaatgctcgagatggcgagctggctgaagcagataggtgctcccga gtacctcgatgtactcgagggggctttcaagctcctcgagaggataggcctctccgagaccaacgtccagagggcggccg caatacttagcggcatgggggagcttgagaaggctctccgctttgccgtcgagatcaaggatccggagaagagggacgac gccctcgcggcgatctcgctaaaactggccgaaagaaaggacttcctggaggccagagaggttgcaaagcttataggaaa ctccatgctgaaggccaggctcctcgaggagatagcaaagattgaggaggagagcaggtgggagata TGATAGGGGTTT TTGACGCACATTCTGATCTTCCAACCCTCGTATGGAAGGAAAGAGGAAAGGGCAAGACCCGAGTCCTTGAGTCCAGGTTT GAAGAGTTCTTCGGGGATTACGTGAAGGCCAGGGTTATGGCAGTCTGGACACCGGTGGACAAGAGGCCAATCGCCCTGAG GTACGGCCTCGAAGCCGTTATGAGGCTGAAAAAAGATGTCGCCGAGAGCTCAAGGCTCGAGATGGTGACATCAGTTGAGG GAATGGAGAGGGCCATAAAGGAAGGGAGAGTAGCCCTGTGGCTCGGAATGGAGGGAGGAGAGCCCCTCGAGAGCCTTGAC GTCCTGGAGGTCTTTTACAGCCTTGGACTCAGGGTTCTGACCCTCACGTGGAGCCTTAGGAACCAGATAGGCGATGGTGT CTTTGAAAGAACAAACGGCGGGCTAACGAACTTCGGAGCGGAGGTCGTTGGAAAGGCCGAGGAACTTGGTATCCTGCTGG ATCTGAG