

>tg0107 hypothetical protein TGAM_0107

>tg0107 hypothetical protein TGAM_0107

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 96253 - 98386 (Additional range around tg0107 is :500nt.)

>Thermococcus gammatolerans EJ3 TCGGAGCGGAGGTCGTTGGAAAGGCCGAGGAACTTGGTATCCTGCTGGATCTGAGTCACATAAACGAGGCCGGCTTCTGG GATACCCTCGATCTGACTTCCTTCCCGGTAATAGCGTCCCACTCGAACGCGAGAAAGCTGTGCGACAACCCGAGGAACCT GAACGACGAGCAGCTGAAGGCCATAGCCGAGCGGAACGGAGTCGTTGGGGCGGTTGCCATACCGAGCTTCGTGGACGAGA AAGATCCCACCCTCGAGAGGTACGTTGAGCACATCATATACATGGTCGATCTTATAGGCTACAGGAGCGTGGGACTGGGC TTTGACTTCGTTTACTACCTCGAGGGCTGGAGCGGAAAGGCCGTCAAAGGCCTTGAAAACGAAGCTGGGATCCCCCTCCT CCTTGAGAGCCTCGGCGAGAGGCTGAGCGAAAAGGAGGTGAAGGCGATAGCATACGGGAACTTTAAGAGGGTTTTTGAAG AAGTAATTGGGTGAGGTGTT gtgatgatagacgagctactcggggagatgaaaattggggagatggtcctcgtagagta cgagcccatctcgtcacccgaggtagtcttccacaggatcgtggatcactttctgaaggaggatgtcccgattctggtgg tagacgttctcgacacgctccatacgttcaacgagcatttgaagaggcgcggtataagactgccggtggacaggctgaca gttgttaaggaagggggaagggtaaggcttggcaacatcatcggggaggtgttcataccctccgagcccagtgagttcac gtatcaccaggttcagtactcgaagacagtcaagcccttctttgagagggacgaaaagccaaaggccataatagtgctcg gcatggagaagttcatactgccgtttcagaacgacctgagaaaggttgagatgtactttgagatgattgagaggccccca atagccccgggtggcaagtacaccttcctgttcataaacaggtcggttgcaagcgagtacgtgctgaggaacctcgagag cgagaagcactacgtcgtggagctaaccggagaggccaaggtcacaaaaacgccattcagcctgctccaggttgggaggg gcctttcactgatagagtacggttccaaggatcacccagaactcgtcctcggtgcggcccttgacgaattcggtgcggag aacgttcttgtggtcgacgtcgtcgacacgggtatggtcgtgggaaagcacctcgaggcaatggaatgggacgttgagga actgccccgcgtggtgaagatagggggaaggtttgaatggggcaggactatagcgacgcttgacatatacaacgagccag cggtgtttctcaggaagctcgacgggatactgcagcgcgaatcacccgggctgatcctctacttcgggatggagaggatc ccaaggttccacagggactcggcgaggataaccctgacgataaccaatagggctgcggttgaactctccgttccttacag tgcggtttacctcataaacagggacacctcgtccccagaactccggggactccttgaagagactgcggaaaccgtcctca tgttccacgacggcggatttaaaaagctgaagggt TAGACGGCCTCGAAGGGACTACCCTTCCTGACAACCAGGCCCCT CTGGGTGAACTCCATGCGGAACAGCCCCGTTTCGTGCTTCGTTCTTCTCATTTTCAGGATCTGAATCGCCCTGACCATTT TCTTCTCGAGCAGGAAGTAGTGGAGCATTATGACACCGCTGACGAGGTAGTGTTCCTCAGTGTAGCGGTTGAGGTCAGTC ATCTCGGCTATAAGGTACGTCGTCACACCCAGATCCTCAAGGCCGCGAACGAAGCGGGCCAGCTCGGCCTTTTTCTCAGC AGGGTTTTCCATTGAGAACTCTATGGCAGTGAGGGGGTCTATGACAAGGCGGGATATTTTTTCGTCCTCCGCTATCTCCC TTATCCTCAGCAGAACGCTCCGCCACGTTGGAACGTGGGCGGATTCCCTCCAGAGAACAGGGCCAAGGTCAAAGAGAAGG AGCCTTTTCGTACCGGCGTAAACCTGAACCGAGGGGTCAAAGCGCATCATGTCTT