

>tg0112 Nucleic acid binding protein, containing 3 OB-fold domains

>tg0112 Nucleic acid binding protein, containing 3 OB-fold domains

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 101766 - 104712 (Additional range around tg0112 is :500nt.)

>Thermococcus gammatolerans EJ3 AACCCCATAAAGGTGGGGACGGGCAGCGTGCTCCACCTGGTCGTCGATGCCTCATCGATGAAGGTTCTCAACCTCTCCGC CGTCAGTCCGCAGCCGTCGCCGCTCCTCAGCACGGCCAACGTTACCGCAGAGCTCCTCGGGAAGACAGTGGTCGTTCAGG GAACGGTTTCGGACTTCAAGACCATCGGTGCGAACCTCAAGTTCCTCGTCGTTGACGGTAGCGGCAACATAACGGTCTTC GTGCCATCCTCAGTTGCCTCCAAGCTCCCGGAGGACGTTAAGTCAAGGCTCCAGGACGGGGCTTCCGTTGAGATTGGCGG CTACGTTACGGAGTACAAGGGCACGATAGAGATCATACCCTACTCGGTGGAGGGCATCGAGATACTGACCTAATCCTTTC ATTTTTTCGCTGGTCATGGTTATACACGAAACTGTTAAAAGCCCGGCCCTTCTACTCCTTTGCTACGTCCCGAAATCCAG AAGTTGAGGGGGTGTTAGC gtgacctcaaacggctcaaatggtaatcctgactccagaaaggaggagaagaagctttac tatcacggacttaaggagcagaagaagatcgacgtctcgaagctgaagtacgtttccctcgttatagcagttctcggtgt cgcgctgatcctcatagcggctcaatctgcgaaggctccaatggcgaagataagtgatgtctacggcaactatctgatga actacgccgttgtcagggtggaaggaaacgtcgtgagcgtcccctacgtttctgaaagtggcggaaaactgagcgttacg ttctccgttaacgatggcaccggctcgatcgacatcagggtttattctccggttgcggaaaagctcatcaaagagggaaa ggttcccttcccgggcgacaggatagaggcggaaatacagctccgcgtgagggaaacctacacctacggaatgctccagt acctcgacgggcttaagttcataagcaaggcctactcccccaatccgcccaaggtgacgaccctcacggaaaagatggcc aacgagtacgtctacacggagggcctcgttacatccctcaacaacgtcagcagcggaatcctgatggaggtggacaccgg ctccggtagggtgactgttctcatacccaaggttctcctggtcattggaaaggctcctaaggttgccctgggtgatcagg tcaaggtcgctggcgtggtttacctctacaagggtagctcgcctgagatcgtcgtaagggatctcaaggactttaccgtc gttggagcccagcaggttccacaggtctcgcttgatgagctgagggatcacgttggagagaccgtttcggtggaggccac cctcgagaagataacctacaagtccgggcagtacctcgtcaccgtcagcgacggagatgtttctgccgtcctgtacacct caagggacgtactggccgcgataaacccgttccaggccggctctggatcgaggatcaaggccattggcctcgttggtgac aacggcacgctcaaggtctcgaagttcgaggttatcagcccggtcaaacccgaactgagcagaatcggggatctctcctc cgagatgctcgggaggatagttgttatcgagggcaacatcgtgagcacggccaacgttggctcgaacctcaagctcgtcg taaacgatggaaccggcgagataaccatcttcatacccggttcggtggtcagggagctcgatgagaacgtgaagggccag ctcaaggccggactcggcgttaaagtcgccggttacctcgacgagtacaggggaacgctcgaggtcataccgtacacccc cgaggccataatcgcctacagaaagccaataggtggaacgactgaaacgactaccaccccgagtccgggccagggcggga acggaacgatcaccctctcccaactgccctcggcgagcggcaccgttaagctggaggtgaagtgggaggccgtttactac tccaagccgaactacctcatcgaggtctctgacgatacgggaagggttaacctcacggtctcgcgggatctgatccccaa cccgctcaagaccgggaccggaagcgagctcgagataacctatgacgccgacaaagacagagtggtctcgattgaggtcg tcaaggccgttgcctcgccgctcctcgagaccggtgaagtctcctctgacatgctcggaaagaccgtagtcgtccaggga accgtaaagagcatctacacgggcagttcattcgtaaagctcacgatagacgacggaagtggcgagctcgtgatcttcat tccaaagagcgttctcggcgacaggacgttcaacgagggtgatatcgtgaagataggcggatacgtgacggaataccggg gaaccttggaggtcgtcccgtacaggggagacgcgatagttaaggag TGAGGTGATGCCAATGGTTCCCCTCTCTGAGG TCCTGGTATGGTCGCTCGCCGGGGTGCTGTTCGGATCATTAATATCCTGGATCCCCGGCTTTCACATCTTCAACATTATG GCCCTGCTCGTGGCGGTCTTCGGCGTCGGCGAGCTGATGCCCGTCCAGGCCTTCCCGTTCTTCGCCATTGGCGCGATAGT TGCTTACGCCTACGTGAGCGCAATATCGAGCGTCTACTTCAGCGTTGCCGACGAGAGCGCGGTGTTCCTCCTCTTCCCGA CCCAGCGCTACCTGCTCCTCGGCAGGGGGCATGAGGCAGTGCTCCTCTACCTCATAGGGGCGGTTGCGGGAACTCTCGTC CTGGTGCTTGGGGCGCTCTTCATCTTCCCCAAGGTTCTCCCGCCGATCTATCAGGCGACCAGCCCGTACATAACGTACTT CCTCACCGCGATAGTGGTCTTCATGTTCATGAGTGAGTGGCCCAAAGAAGGCGACAGGGGAAAAACAC