

>tg0114 Peptidase, prolyl oligopeptidase family

>tg0114 Peptidase, prolyl oligopeptidase family

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 105305 - 108173 (Additional range around tg0114 is :500nt.)

>Thermococcus gammatolerans EJ3 GGCAATGAAAAGCGCCCTGAGAGTGTACAAGAGGGAGGGAAAGCTTTCAGCCGTGCTGGACGTTCTGGCCACCCTTTGAG CGTTTAATCCTATCGTGAAGGGCCGCTATCACAGGCACGATTATGGCGAGAGTTATGAGGCCCGCCCTGGGGTCCCAGAA GTAGTCAAAGCCTAATATGACCGCTATGGCTATCCCGATCATCACGAAGAGGTCCCTGTCGTAGAGCCTTGACTTCGCGA GGATGTTCTGCTCGCGGGCTATGTACGCAAGGTAAACCGGGATCCCCATCGCCGCGAAGACCACTCCCCAGTACGTCCTC AGCGCGAGCGAGAGCACAAGTCCCGTGCTGAATATCACCGCAACGGCCGTTGTTTCCTTCATAGCCTTCACCTTCCAGCG TTATCGGCGGGCTCCTTTTAAATGTTCCCCGGGTTCAGCAATGTCCATTGAAGTTAGGCTTATATACTTCGACGCTTATC ACAATCAGGTGATAGCGTT atgagcggtatcgaatggaacgagaagaccttttctcggttcgcctacgtgaacgacccg aggattaaaggctcgagaatagcctacaccctgaccaaggtcaacatgaaggacaataagtatgagagcacggtggtcgt tgaggacattggaaagggctcaaggcgtttcatagagaacgcctcaatgccgaggctctcgcccgatggcagaaagattg ccttcacgaggcccaacgaggagaagaaggaaactgaggtctgggttgccgagctcgaaacgctctcggcaaagaaggtt ctctccgccaaaaacatccgctccctccagtggaacgacgactcgaggaggcttttggtggtcggcttcaagagacacga cgatgaggacttcgtcttcgacgatgacgttcccttctggttcgacggcatgggcttcctcgacggcgagaagacgacct tctgggtcctcgacacggagagcgaagagatcatagaggagttcgagaagccccgtttcagctcgggcctctggcacggc gattcgattgtaatcaacgtcccgcacagggaaaacggaaagccggccctcttcaagttctacgacataatcctctggaa ggacggaaacgaggagaagctcttcgagcgcgtttcctttgaggcggttgattcagatggaaaagccattctcctcaggg gcaggagggagaagaagttcatcagcgagcacgactggctctatctgtgggacggcgagctcaagcccgtctacgagggc ccgctcgacgtctggggcgcgaagctcaccgggggcaaggtctacttcctcactccagattcgggcagggtgaacctctg gctctgggatggtaaagccgagcgcgtagtagctggcgaccactggatttacggcctggatgccagcaacggaaaggccc tactcctcataatgaccgccacgaggataggcgagctctacctgtacgacggcgagctcaagcaggtcaccgactacaac ggcccgatattcgccaaactgaaaaccttcgagccgagacacttccgctttagaagcaaagacatggagatagacggctg gtacctcaaaccggagctcaaggaggatgagaaggcccctgtgatagtcttcgtccacggcgggccgaagggaatgtacg ggcaccgcttcgtctacgagatgcagctgatggcgaacaaaggttattacgtggtctacgtcaatccgcgcggcagcgac ggttacgacgaggacttcgcccttcgcgtccttgagaggactggcttagaagacttcgaggacataatggccggaataga ggagttcttcaagctcgaaccgcaagccgacagggagcgcgttggaataaccggcataagctacggcggcttcatgacca actgggcgttaacgcagagcgacctcttcaaggctggaatcagcgagaacggcataagctactggctgacgagctatgcc ttctcggacattggcctctggttcgacgtcgaggtcatcgggccaaacccgctggagaacgagaacttcaggaagctaag ccccctgttctacgcaaagaacgtgaaggccccgattctgctgatacactcgctggaggactaccgctgtccgctcgacc agagtctgatgttctacaacgttctgaaggacctcggcaaggaggcctacatagccgtcttcaagaaaggcccacacggc cacagcatcaggggaagcccgaagcacagggcgaagcgctacaggctcttcatcgagttcttcgagaggaagctcaggaa gtacgaggagggcttcgacgtggagaaggttctcaagggcggggaggaa TGACCACCTTTTCTTAACTTTCTTCAGAAA GAGCTATATACTGCTTCTCGGAACTGGGTAGAGGTGAATCTCCATGAGGGTGAAGTTTGCCCTAGCGTTGCTCCTGATAG GTCTGGTCGTGATCTCGGCCGGCTGTATCGGGGGCGGCTCCAAGGAGAGCACTCCAACCACCTCATCGACGACCAGCTCT CAAACCCAGACAACGACTTCCGCTGCTCAGACGACCACAACCACCACGACGACAACGACATCTCCACAGACCACCACTAC ATCAACGCCTTCCATTCCCAAGGTGTCGATAGGTGAAATCGGGAACTACGTCGGAAAGAACGTCAGCGTTGAGGGCCTTC TCCTCGGCATCTCCTACGACTCAGCGAACCACGTCTACGTTATATCAATGGGCGAAAACGGTGCGAAGATAAACGTCACG GCGAAGCGTGGGCTCCTGTCGGTTCTCAACCCGCTTGAGGTTGGCGTTGGCTCCAAGATCCTGGTGACCG