

>tg0134 hypothetical protein TGAM_0134

>tg0134 hypothetical protein TGAM_0134

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 131355 - 133641 (Additional range around tg0134 is :500nt.)

>Thermococcus gammatolerans EJ3 CCTGGGCCCGTTGTAGAAGGTGTAGTCGCGCTTCTTGGTGAAGTCAATGAACTGGTCGGTTATGACGATGTCTCCCGGTT TATACTCCTCGCGAAGCGAGCCAACTGCCGTAATGCCTATGACCCTCTCAACTCCCAGCTCCTTGAGCGCCCAGATGTTC GCCCTGTAGGGAACCTCGTGCGGCGGGAACTCGTGGTGCTTGCCGTGCCTCGGTATGAAGGCAACTTCAACGCCCTCGAT TTCGCCGATTTCCACCGGAGCGGAAGGCCTTCCGTAGGGCGTGTGGACCTTCACGGTTTCTTTCGGCTCGAAGACACCGT AAACCCCGGAACCACCTATAATGCCTATCCTCGGCATGGTCATCACCGTGTTAAATGCTTGCTCCACTCATATAAGGGTT GCCTTTCCGGTGGAGAAGTACTATCGAAGATGGTGCTCTTAATGAGGGATGAGAGCGAAAAGAATATAATCTCCGCAGAG TATAATCCCTAGGCGGCAG gtgataagcatggagcgaaaatggatcgctgcggtcgttatcgttttccttatctcatcc atcgccctcgcctacgagcggcactctggggaaatggaaaacccctccacgttcgccctcgcactccagccccttcccaa cggaaagctcacagtccttgagaaaggatccctcggaaaggttctcggggcaacggtccgcaacggagaatgggtaacct atctaaaggaggactcacacgttctgaagagcgttccagcaccaatagttctttacttcaccagcgacaacaggatcgtt gtgggaacgttaaaggacggaaagttaggccaaaccgtcgaactcaacctaaccaaactgctggagcgcgcagggagcgg aaacgccggaaagggagtttctgagtgccccaaaggatacgtacaggtttcagataggtactgcattgacgaaaacgagc ctgtggttaagggacgtgtgaagctggttcaggagtgggtaccgttcatgggcatgaagatcgacaccgtccgcgagccg atcaacgtggtcagcctctcctgggggataatcctcgacagtacggccgtcgcggattacaccctcaacgtggcgggtac accggcggcagtgccgggcaacgaatacgatggggagaagctcaggatagcgtacagtcccgagggcatagggcttcgga cttcgaacggcagcatcgaacgctacgtgaacctacccctcaggtacctcaccttccagatggaggtcgcgtgctacgat agatacaccggagagtacacccacattccgatttcgggcacctatcccgttgaaatccagctgacgggagagtacaatct caccgaaggacagctcaacaagaagatcacatccagcacaggtatggagggttctattctcacggatcaccccatcaaaa aaggcctgttcccgacgatgaactcaagcagacagataagggtgggacagaatggctactacacaaacatcgtttttgac tttcaaggaggtagagggtatttctacacctttcccgttggcgggagcgatgataacccatccggagaagccagcgctca gcgtttcctcaccataagctactccccacatgcaaagtccttcctgacgtattctatcacgataataagggcaacaccca acgccacttacatagtggcaacccctgaaatcccaatcaaactacccggcggcgaagacgggggagaagtggccacttac ttcaccgtgataacggcaatgagaacc TAAATTCGGCATCCTTTTCCATTTTGGTTCTCTTCTTCCAGCACGGCACGCA AACTTTAATAACCTTTTGGAAATAAATATTCCGGGGGTGGTGAGAGATGGAGGAGAAACCAGTCAAGCTCGTCCTGCCGG AGGTAAAGAACCCGATATTCATCGAGGGTTACCCCGGGATAGGTCTCGTCGGCCACATAGCGGGCAACTTTTTGGCCAAA GAACTCGGAATGGAAATGATAGGCTACGTCGAGAGCCCGTTCATCCCGCCGATGAGCATAGTCCTCGAGGGGAAGCCCAA CCCTCCGCTCCGCTTCTACGGCAAGGACAACGTAATCGTGGCGGTAGCGGACATCTACGTTCCACCAACGCTGGTGAACG AGATAGCGAAGGAACTCGCAAGCTACCTCAGCGAGATGAAGGCCGAGAAGGTAATCTCCATCGGCGGAATCGGCATAGGA TTCTTCAAGGAGAAGATGGAAGTGTGGGGCGTCGGCGCGAGAGAAGAG