

>tg0156 Site-specific DNA-methyltransferase (cytosine-N(4)-specific)

>tg0156 Site-specific DNA-methyltransferase (cytosine-N(4)-specific)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 152725 - 155119 (Additional range around tg0156 is :500nt.)

>Thermococcus gammatolerans EJ3 TAAGAAGCTCCTCGTTGAGATACGCTCGACGGAGAGAATGGACGTTCCGCTCGGCTCTGATGGGGAGCTCTGGGTCGATG AGGCCTACATCGAGAAAATCGTTACCATAGCGAACGACCAGCTGAGAAGGTTTAAGAGAAAGCTGAAGAGGCTGGAGGAA GAAATTGAATAGAGAAGTAGAATTAGTGCTTGGTGCTTGATTTTTTGGATTTTTGTACATTGCTTAGCAATCCTCTTTCA GTTAAATCTTTTCTTATCAATGAACGAATGTAGTCACTTATACTTACGTATTCATTTCCAATGAGCTCATTTTCTATTAT ATCAACCCATTTTGAGGGAACTTGAGTTCCGAGAACTACATTGTTTTTCTTAGAGGTTCGCGTCATGTTGTCATTCACCA TAATCAAGTCAATTAATTGATGATTTAAAGGTAACCATAAATTTTAAATATATTTAACCATACTTAACAACAAGGCTGCA CATCCAAAAAATATAAAAGA ttgcatctaagaggaaggtgggaaacaatgacactagataaatggattcactttaagtc atcctccgttagtgaaaaaaaagacattgatagtattctgacggaattatctaggaaagtttctcaaaaagttacttttg ttaacaatgctaatgaacccattcatagatggtttaaatttcctgcaggattttctgcgtcgttagtgagaaattctatt aatatttttagaatcacatctaaagatactattcttgatccttttacaggttctggaactgtaaatgtagaagcgaagag actcggaataacttctgttggtgttgaggcacatcctctcgtagctaaaattgcccagataaagacttattgggaatttg agccaaaagaattatacactcatgttacttcaattataaatgacattgaacgaaaattaaactctaaacgcatacttcat gattatgaagatcagataatgaaatccccaaaattattgctaaaagtatatcctcctgaaactttagcaagattatattt tattagagactacataacacatactaatattgacgatcacattagagactttttactgttggcactattaggtattttga gagaagttacagatgtcgatgttggatggccatatatcttgcccaagaagaaaaaaagaatagcaaaacctgtaatggaa gcatttagggaaagagttcttcttatgtaccatgatctaaaggaagtcaaagaacaagtacagaacccggcaatggcaga aatatataactttgattctcgatttctggccaaaataataaacgaaaatagcattgattttatttttacttctcctcctt atttaaacaattatgactatgctgatagaacacgacttgagctgtattttttgggatggtgtactagttggagagatata actgagaaaattaggagaagattaatgatagcggccaccacacaagttcagcgatcaaaaatgagaaatataaaactaag tggtctgatacctccagaagttacagatgaactaaatgaaaaaataagtcagctggctcaagaacgagaaaaaagaagtg gtaaaaaagactatgatctcatggtacttggatattttaatgatatatctagaattctatctcagatgtatgcagtatta aaacccaaaaaatacgcagtaatcattgttggagattctgccccgtatggggtatatattcctacacatgaatatatagc aaaaatatccaagtttgtaggtttctctgactataggatattactactacgagaaaggggcaaaagatggaaagcaatta agggtatacggaggcacaacatagatttaggagaatacatggtagtgctaaaaaaa TAGAATAGCTTTTTTATTTTAGA TATTTGTCAATTTTTTCTTGTTGAGTTTTTAATTTTTGCTTGGTTATTTTATCAATAAGAGAGGAAATGTTTTTAGTGTC TGCAATACAATCAAGAAACATCCTAGCTTCGTTGATATTTTGGGTATCCAACGAGATTATCCTACCAATGTTAGTATATA TATCAATATTTATTTTTTCAATTTTTTCGTTATCTGGGTTGATTGCTTCGTCTAATAATTTAAAAAGTGGCTTACTGATC TGTTTTTTAATATCTTCTTTGATATTTGTTAAGGGATCAGAGGTATAGGAGATGTTATCCAGTAGTACTACATCAGAAAA TTCTTCTTTGTTTAAAATCATCTTAAGCTTTAAGAGAGATAAAAAAGGGGTAACTCTGTCTTTTTCATCCCAGTTAATTT CTATTTTGAATTTTTTGAAGATTTCAGAAAATTTCTCAAGAGGAAGTGTTATTGTTTTTATTTTTTTATGATCCAT