

>tg0157 hypothetical protein TGAM_0157

>tg0157 hypothetical protein TGAM_0157

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 154136 - 156251 (Additional range around tg0157 is :500nt.)

>Thermococcus gammatolerans EJ3 GCAACGGTGATAGCGGCCAACGAGATACTTCCACCGGAGGAGTTTGCCAAGCGTCTCGACGAGGAGCCCTTCTCAAAGGC CTGGGAAGCCATGAAGGACGGTTTTATCAAGGCCGTTGCCTCAGAACTTGCCGTCGTTGGGGACGCTAAGGAGATAATCC TCTCGGGCAGGCTGATGCGCATAGACGAGCTCCGGAAGGACGTGGAAGACACATTCGAGGAGCTCTTTGACCTTCCCGTC GTCAGGCAGAGGGGCCTTGAGGGTAAGGCCAAAGAAGCCGCCCAGGGGAGCGCTATAATCGGCGACGGCCTCGTGGGGGG CCAGTTCAGGGAGCTCGTGGAGCACGTGGAGATAAAGAAGAGCCGCGGGAGCGTCCTCGACTACGTAAAGCTCCCGCTCG ATGTTTAAATTGGCTGGTTTGGTATCCCTTCGGTTTATGGAGCTTGAGGGGTGAGCTTTTTAAGTATATTTGCCAATTAG TCCATAGGGATGTCTTACA atgagggggtgttatgaagaggttagagagactcttgaagaagctattagcaaactaaat aataaaaatatccgtattaataaagatcccccttggatcattgtctctttacgaagtcaaccaaaagcatatctttatgt taattgtaataaagagatactcaaagtatttctatgcctcaataaagaaaaaactccagattgtatacttgtatatgata caaaatctgaagttaataaagaagtacttagtaacaggcttaaaattttacttaaagttgcaactaatagcaactatgct tctacactgggagaagatttaggtagaatacttgaagattctattcatgaaatattattggagttttccaagaaacataa aaatgttaaagtgtcaagagaagaaaaatggaaagaccgggatggcgatgagcataagttggattttataatatatgtga acaataagcctgttgttgttttagaatctaaattccttagatataaaaagcatatgcgagataaaggtagtagagtaata gactctttgactgaaattcgcaaacggtatccttctattgctatggctattgcaatattagttggaaattggacaaaagg atcacttaaagctatggatcataaaaaaataaaaacaataacacttcctcttgagaaattttctgaaatcttcaaaaaat tcaaaatagaaattaactgggatgaaaaagacagagttaccccttttttatctctcttaaagcttaagatgattttaaac aaagaagaattttctgatgtagtactactggataacatctcctatacctctgatcccttaacaaatatcaaagaagatat taaaaaacagatcagtaagccactttttaaattattagacgaagcaatcaacccagataacgaaaaaattgaaaaaataa atattgatatatatactaacattggtaggataatctcgttggatacccaaaatatcaacgaagctaggatgtttcttgat tgtattgcagacactaaaaacatttcctctcttattgataaaataaccaagcaaaaattaaaaactcaacaagaaaaaat tgacaaatatctaaaa TAAAAAAGCTATTCTATTTTTTTAGCACTACCATGTATTCTCCTAAATCTATGTTGTGCCTCC GTATACCCTTAATTGCTTTCCATCTTTTGCCCCTTTCTCGTAGTAGTAATATCCTATAGTCAGAGAAACCTACAAACTTG GATATTTTTGCTATATATTCATGTGTAGGAATATATACCCCATACGGGGCAGAATCTCCAACAATGATTACTGCGTATTT TTTGGGTTTTAATACTGCATACATCTGAGATAGAATTCTAGATATATCATTAAAATATCCAAGTACCATGAGATCATAGT CTTTTTTACCACTTCTTTTTTCTCGTTCTTGAGCCAGCTGACTTATTTTTTCATTTAGTTCATCTGTAACTTCTGGAGGT ATCAGACCACTTAGTTTTATATTTCTCATTTTTGATCGCTGAACTTGTGTGGTGGCCGCTATCATTAATCTTCTCCTAAT TTTCTCAGTTATATCTCTCCAACTAGTACACCATCCC