

>tg0186 Thermostable carboxypeptidase 1

>tg0186 Thermostable carboxypeptidase 1

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 176738 - 179234 (Additional range around tg0186 is :500nt.)

>Thermococcus gammatolerans EJ3 AGCTATGTGGAAGAGCTTGGCCTTCAGGTACTCCTCCGGGATCGGCGTCTCGCCCATTCTCTCGGCCACACCCACCTCAA CGGGCGACTCGACGCTTCCATCGGGTTTGTAGATAACCCAGATGTGAATCGTCTTTCCGGGCAGGACTTGAACTCCCCTG ATATCGACGTATTTCGCGAGCTTTTGGAGCCATTCCCTCGGAAAATCCTCGCCAACTTTAGTGACGAGGCCGACCTTTGC TCCCGCCAGAGCGGCAGAAGTGGCCACTGCTGCCGCCGCCCCTCCGGGCATCTCGATTCTACCCCCGTCCGGGAAGACTA TCGTGTCTATCGAAACGTGACCGAGGACGACGAGTTCTACTTCCATGTTTTCACCCGACCGCTGTAAGCGTTACCCCCTT AAAGCGATTTTTATGGTTGTAATTCACTTCCAACTTTCCGTTTAGATGGACGTCGAAAAGATTTAAAAGCTCGGCCTCCA AAGTTTCCCGGTGGTGTTT atgaacagcgtcttccagaacgagacgatcagagagattctgaccaagtaccgcaggata tgggccatcggccacgcccagagcgttctcggctgggacatggaggtcaacatgccgaaggagggaatccttgagaggag cgttgctcagggggagctttcagtcctcagccaggagtttctgctcaagccggacttcgtcgagctcgttgagaaggcga agagcatagaggacctcaacgagtatgagcgcggcgtcgttcgcgtcctcgaccgctcgataagaatcagccgctcgttc ccgcccgagttcctgagggagatgagtgaggttacgagtcaggcgaccaaggcctgggaagaggccaagaggaccgacga ctactccaagttcgagccctggctcgacaaaataattgatctcgccaagagggctgctgagtacctcggctacgaagagg agccctacgacgccctcttggacatgttcgaggagggactcaggactaaagaagtcgagaggatgttcgacaagctcgag aaggaactaaagcccctccttgagaggataatggaagagggcaaggttccgcagagccaccccctcgagaaggagaagta tgagagggagcagatggagaaggtgaacctctggattctcgagaagttcggcttcccgcttggagttcgctcaaggctcg acgtttctgctcacccgttcacgaccgagttcggaataagggacgtgaggataaccacgcgctacgagggctacgacttc aggaggacgatactgagcaccgtccacgagttcgggcatgcactctacgagctccagcaggacgagcgcttcatgttcag cccgattgcaggtggtgtctcccttggaatccacgagagccagagcaggttctgggaaaacatcatcgggcgctcaaggg agttcgcggggctaatctaccccgtcctgaaggagaacctgcccttcatgaccaactacacgccggaggacgtctaccta tacttcaacatggtcaggccagacttcatcagaactgaggccgacgtcgtcacctacaacttccacatactgctccgctt caagctcgagaggatgatgctcaacgagggcgtcaaggccaaagacttaccagagctctggaacgaggagatggagaggc tcctcggcataaggcctaagagctatgcagagggcatccttcaggacatccactgggcgcacggaacaataggctacttc ccgacctacagcattggaacgctcctcgcgagccagctctactaccacatgaagaaggacatacccgacttcgaggacaa ggtggccaaagcgaagttcgagcccatcaaggcctggctgagggagaagatacaccgctggggaagcatctatccgccga aggagctcctaaagaaggccatcggcgaggaactgaacccggactacttcatccgctgggtgaaggagaggtatctg TG ATTTCTTTCTTTTAACCTTTGAGAAGAGCGTTTAAGTCTTCTTTCGTCAGTTGTGGATAGCTCTCAAGTAGGTTTTCAAA GCTCCAGCCGTTTGTGAGGAGTTCGAGTATGAAGTAAACGGGAATCCTCGTCCCCTTGATGACGGGCCTACCACGTTTTC TTGGGGTTTATCCCGATTCTGTCGCCAATCATTTAAGCTGTAACCTTAAAACGCTTTTTGCAGTTTATTTATGTAGCCTT TGCGGAGGTGCTGTTATGGAAGAAACGGAAGGAAACGCTTGGGTGCTTGAGAAAATCACGGGGATTCTGGGCGAGGAGGA ATGTTGGATGACAATTGAAAACCTTAGGGCCATTAAGAAAGAGTTCGAGAAATGAGGGCAAGAAATAGGCTCATTCTAAC GGCTCCCCAATCCACGCCACCGGTTCGACCTCTATCGCAACTACGCCGTACTTCTTCTCCTTCTCCTCGGAATAAAACTT TCTGTAGACCTTAACGCC