

>tg0189 MoxR associated protein, containing DUF58 and Von Willebrand factor, type A domains

>tg0189 MoxR associated protein, containing DUF58 and Von Willebrand factor, type A domains

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 179620 - 181861 (Additional range around tg0189 is :500nt.)

>Thermococcus gammatolerans EJ3 AGGAGGGAACCTACCCCCTTCCCGAGGCCCAGCTGGACCGTTTCCTCGTCAGACTCCGCGTTGGCTATCCCAGCAAGGAG GAGGAAATTGAGATACTCAGAAGAAGGATGGAGAGGAAGAAGGAGGAAGTCGACATACATCCGGTCACGACGCCTGAGGA AGTCGTGGAAATGCAGCGCGCGATAGAGGATGTCTACGTCAGCGACGCGATACTGGAGTACATAACCGATATAGTCACGG CAACGAGGGAGAACAAGAAGGAGATCGAGGTCGGGGCCTCGCCGAGGGGAAGCCTGGCGTTACTCAAGCTCTCCAGAGCG TACGCAGCCCTCAACGGGAGGGACTACGTCATCCCCGACGACGTCAAGGCGGTGGCCGTTCCCGCTTTGAGCCACAGGCT CATCCTCAAGCGCGAGCTTTGGTACACGAGGGTTAGCCAGGAGAGTATAACGAAGAAGCTCCTTGACCGCGTTCCAGTTC CAAAGTTCGAGTGATGGCC atgcccggggaaataaagcccgaactgacggagagggctgcggaaaccctgcttgcgatg tggctgatactcatctcggccttcttcttcctgagatgggagctggcctatctgatactccccatactctgggtcttctt cgtgtcgatcttctttttcagacccgagataaagctcgaggtgaggagggagataccccacgatagaatgctcgaaggtg aggtagccgagataaggctgagggtaaaatcgaacgcaaggataccaagcctcaagatcgaagaagacatccccgatggg ctcgaactcgtggaggggagccgggagcacgtgctctccctcggaaaggatgaggaacgtgtgataaagtatagggtaag ggtcaggcggggaatacacgagttcaacggcgtaagggtaagttaccgggatccgatgggcttcttcaagctcgaccact tcatagagcactacaccgaactcataggcatgcccctcatcgaggacgtcccaacgccatactcaacgcggggaaccaag atcaccgccggcccgctgccatctccgagaatcggtgagggagtcgagtttcacgccatcagggagtaccagcccggcga tccactgaagataatcaactggaaggcaacggcaaagacaggcaagataatggcaaacgagtacgaaagcgagaggaaag tggatgttatattcatagtggacgcatcctacagggggcggagggtcttcgaccatctcgttagggctgccgcctccctc atgctcaacgccctcaacaacggaaccagcttcggtttgctcctggcggaggccgtccccctgtgggtgcgcgtcgatta cgggaagagacacttcttcaagtgcatagacttcctcagtacggcgaagcccgataggaacaacatgatagcctatcagg tcgagcaccttattagatcccgcttccctgcaagggcccagctcctctacttctccacgctcctcacggaggagagtagg gaggcactgagaacgatgtcggcttacggttacagggtcgtcgttatttcccctgacccgtacagcctcgtcgagccgaa gacgaaggaggaagagctcgcagtaaggatccttagactaaagaggaaggcacagctcaggaggatggcaacctacggga tcataatcgactgggacgtcaaaaaacctctcaaagcggccatcgcagaggtgatccatcca TGAGAAAACCCAAGAGA AGGTTCCACTCCCTGATCCCGCTGGTGCTCTCAATCTACCTGCTCTACACCGTGGACAGGTGGAGCCTTCTCCTCCTTCC CCTGGCACTGCTTGGGGTACAGTGGCACTTCTTCGGCATGCTTTTCCTAACTGGAGCGGGGGTACTCCTCGTTTACAGAA ACGTCGGCGGGGTGCTCGGGATAACCATCGTTGCCTTGGCACTCCTGACGATCGAGATGGGCCAGATGGACAAAGAAAAA GCCCCCTACGAGCACTACGCAGTTCTAATACTGGCGGCATCCATGAGCATTCCAACGTACCTGCTGATCCGTACGATCTC CCCATTCCTTCCCCGGGTGGAGGTCACGGCGGTGGCCGCTGGCGTTGTACTGGCCCTCTACCTCTTCACGAGAACCGCTG GAGAGGACTAAACGCTCCAGCTTCCACTCTTTTTCAAGACCTCCCTGGCCCTTTCAAGGCCGAGCCTCGCGCATTCCTCC AGA