

>tg0196 Bacterial type II secretion system protein F

>tg0196 Bacterial type II secretion system protein F

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 185154 - 187227 (Additional range around tg0196 is :500nt.)

>Thermococcus gammatolerans EJ3 GGGCACCATCCACTCCAACAGCGCCCGTGAGACGATAGTAAGGCTGGAGAGCCCGCCGATGAACGTTCCCAGAATAATGA TACCTGCCCTCGACATAATCATCATGCAGGTTCGCTTTAACAGCAGGAAGAAGGGAACGGTCAGGAGGATTACGGAGATA GCCGAGATCTCAGGAATTGAAGGTGAGAGCATACAGCTCAACAAGCTCTACAAGTACGATCCGGCCAAGGACGAACTCCA GCCAACAGAAGTGCCGAGCAGGATCATAAACGAACTCGCGAGGCACACGGGAATGAGCATAAGTGAGCTGGAGATAGAGC GGGAGAAGAGGAAGATAATCCTGGAGTGGATGATGGAGAAGGGAATCCGGAGCATAGAGGACGTTGGCCACTACATCAAG ATGTTCTACATCGATGAGGAAGCACTCCTTGAAAAAATAGAACGTGACAGCTCGGCCCAGATACAGGAGCAGATCAGGAA CATATCGTGAGGTGTTCGT atgggggtcatagaatcattcctcaacttccttgaaaggcttggaggcacgacgcttgaa gtcacggaaaagccggttagaagactcccccgccggaaaagcatccaggagaggctcagagctctcaaagaaatccaaaa ggaaaccgaggaaagcaaggaaagcgagagggagagggaactcgaggagatccttgaatggaggagaaaagagataacga cctcatttggggagaggttggccgaagccttcctcaggaggttcaaggggccagtcgagtccctgacgaagtcaataaag ggcctcgactacgatctctaccgcgcaaacatcaggatgtcgaaggagaagtacgtggccctgatgatcataacgtccat cttcctgggagcgttctcgctagccttcggactgttgctcgagatggacgttttcacatcaatgatgctcggactcctgg gtttcataggcggcttcctctacatgagacactacccgaggatggtgtggaggcgcagggttgcggaggtcgaaaaggcc ctcccctacgttctcaggcacatagcttccctcctgagcgcgggagttggtatagcggaggccctggtttctgttgccaa agcggattatggcgttgcctcggaggagttcgaactcatagtaagggatatgcgagcgggagcatccttcgaggaggcac tcgagaggttcgaggaaaagatgggctccgagaacgtgagcagggttgtgaagcagatcctcagggcaataaagttcggt ggaaacctcgcggagatactctacaagatggcggaagactttgccttcgagtacaggatgaagctggttgaatacgtgca gaaggtaaacggtatagcgttcatatacatgttcatgacaatagtcatgccaacgatgttcatcgtggccatactcgccg gctcggccttcagcgcccaagggggaggggggaccctggcactctcaccctcagcactggcggtcatactgctcttcgcg tttccgatgctgtccctgataatagttaccatgataaagcgcggtgagccgagg TGAAGTGAATGCCGAGGGAATCTGG AGGAATAGCAGTCCTGCTCACGAGGATCCTTGAGCGAATCCTGCCGGCGAAGTGGATAAAACGCTACGAGCTCTTCATAT ACTCCGCAGGAATAGAGTTTCTGGCAATAGAGTACCTCATAATCTCGATCCTCCTGTCGATTATCTTTGCAGCCGTCGTC CTGATACTGTCAAATACCTTCTACGCCCTTGTAACGCTTGTGGCCGTTTTCGTGGGCATGGCGTTTGCCTATCCTTACTG GAGGGTATCCAAGAGGATAGAGGAGATGGAGAAACACCTCCCGGACGCGTTCTTTTATCTGGCCAGCTCCCTTAGGGCGG GCATATCTTTCTCTGAGGCACTCGAAGACCTCACAACCGCAAAGTTTGGGGCCCTAACGGATGAGTTCAAGAGGGTCGTG GGCGAGATCAGAAAGGGCCGTTCAACGGTCGAGGCACTTAAGGTTATGGCTGTGAGGAACAGGAAGTCCCCGGTG