

>tg0223 hypothetical protein TGAM_0223

>tg0223 hypothetical protein TGAM_0223

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 213690 - 215871 (Additional range around tg0223 is :500nt.)

>Thermococcus gammatolerans EJ3 CCTCATCTGGATCCATGAGCATCTGGCAGGAGGAAGTACCAAGATCCTCTACTACGACGACGATGAGCTCATATTCATGC GGGAAGGCTACGGCGACAGGCCCGGGCTCATAACCTACATCAACCTCGGCAGCGGCTGGGCCGAGAGGTGGGTGAACGTC GGCTCGAAGTTCGCCGGGTACACCATCCACGAATACACTGGAAACCTCGGTGGTTGGGTCGACAGGTACGTATACTATAA CGGCTGGGTCAAGCTAACCGCTCCGCCTCACGATCCGGCAAACGGCTATTACGGCTACTCAGTGTGGAGCTATGCGGGAG TTGGATGATCCTACCTGGTACTTTCGTGCTAATTTTCCTTGAATTTTTATCAAGCTATTCTATCTTTTTATTCTCCCTAG GAACAGAGAGTAAGTAGTAAAGCTTAAATGCAACCATAGTATACATAGACATCAGCGTCATTACCCATAAACAACAAGTG GGTTTAGTGGGGATGGGGGG atgaacaagcaattggtctttatcttcaccctgttatcttttctcattttgtccacccc tgcggttaaagcagacaaggtaatggccagtatgcactgtatacctacctccattgagccgggtggtgcagtaatttgtg atattgatttcaaattgcttaaccccaatgaaactgccactctcaaactcaaaaaagtatatctcgaagacaaggagatc tggcccagggggccatctcggggaaccgtaatcgttccaaactctaaattccaccttggtccccatgacatagagggctc aatagcgataacacttactttcaacaatgaaatggctgattgctattttgggaagcctgtactcgatgactacagagaca agtttggaggcaggacatacaaaatcaccgcggtggttgacgggatatctacccctgtttccgcccaaataaagattaaa aacacaggactgtgggattcctttatctgggtcctggagtatctgatagtgttgatatacctgatatccatagctgtatc cctttccacgaagaattttccaattggatctcttcttttggtagttttctcagggtttgttggggtgagtatagcgagaa ttgcaagtggtctccagtggaacttgaaatacggatattggtctcccgacatcccatccattgtttttctaatttcgatt gtactgatctctgctctggactataaggaagacaaaaaaagctggaagctgattttatcgggtctcttatggctcctaat ggtaacagcggcaaagtatggctccaacggtgatgttcttgcaatagtgctctcattgaccctatgggtgacagtggagc tcgtggggattacaggtaaaagagtcaaagcatacaaaagggagttgtcttccgtggtagtagctccttatttgataccg atatcataccatctcatgttgagtgtttcatcgtttgtcttctgggtatcgtcatttttcattttcctcgttgcaatact gtttgtgaacgtgctttaccactccaactactcttccaagcgctatatagtattaatgtctccggccctagtcttattgt ttatgacaaccaattccccttacttcttggcctacgctcttcccttgctggggataacctttctttatgaaaggtgggat aat TAATTAAAACTCCTCCACCCATTTTATTGCCTTTGGCACTCTTTTCGCAAGCTCCAGCGCGGTGAAGTTTTCTCCG AACTCTTCCTTTACGATATCCCCGGCGAGGCCGTTTAGGAACGCCCCAACGGAGGCAGACCTCAGGGGGGAGTTTCCAAA GGCAAGCAAGGCTCCAACGAGGCCCGCCAGGACGTCGCCCGTTCCACCGGTAGTCATTCCGGTGTTGCCGGTTCTGTTGT ACTTCCAGGTTTTTCCGTCGCTTATGACGTCGTAGGAACCCTTCAGAAGGATTACGCCTCCGATTTCTAGGGCCTTCTCT CTAACCAGTTCGGCCCGTTCCAGCAACCCCTCAGGGGGTTTGACACCGAATAAAATATTGAACTCTCCAGCGTGGGGAGT TAGGACGAAGGTTTTCCCTTCCAGAACGCCCAAGTCTTCGGCCACCGCTTTGAGACCGTCGGCGTCTATGACCATCGGTC TTTCACAGCGCTTTACGAACTCC