

>tg0224 Carbohydrate kinase, putative

>tg0224 Carbohydrate kinase, putative

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 214878 - 217317 (Additional range around tg0224 is :500nt.)

>Thermococcus gammatolerans EJ3 GGAGTGGCATACGCAATAGCCAAGGCCGCCGCCGGAAACGTTGCCGAGTACATCAGGATAAGCAAGGAGGCCATGAAGAA GCAGCTTGGAAAGGACCACATAGAGCACGGCGAGGTCGTTGTAACGCCGGCTATGAGACTCGAGAGACATGGAATTCGCC ACGTTATCCACACCGTTGGCCCCTACTGCGGTGGGACCTGGGATGAAGACAGGAAAGATAAGCTCAGAAAGGCCATACTC GGGGCCCTGAGAAAGGCCGACGAGCTCGGCGTTAAGAGCATTGCTTTCCCAGCGATAAGCGCCGGAATCTACGGCTGTCC GCTTGAGGAAGTCGTGAAGACTTTCAGGGAGACCGTCGAGGAGTTCTCAAAGGAAGCGAAAAGCGTGGAGAAAGTTTACC TCGTGCTGTACTCTGAAGAGAGCTATCGGAAAGCGCTGGAAGTTCTCAACGGGTGAAGTTTTTATCGCCAGTTTCTAAAT ATTCTCTTGGGTGGTGCTC atgcgcatcgaggacgtttacgtctgggatctaaacgccaagtggcttgggattacacct taccagctcatggaaaacgccggtgctggagtggcaagggttatagaggagcgctttggaaggggcctcaggattgcggt cttctcgggaaccgggaacaacggtggagacggcttcgttgccgcgaggcatctaagcttcgagaacgacgttacggttt ttctggtgggcgacgaggccaagataaggagcgaggaagccaggcacaactgggagatactcaaaaggctcgacttcgtg gaaattaaggttctcaaggactccgcctacatcaaagagctcgacctgagcggttacgacgtcatcgttgacgcccttct tggggcgggcacgaagggcgaaccaagggagccagtacgctcggccatcgagaaaatcaacgagtacgcgggaaaggcaa aactcgtcagcgttgacctgccgagcggttatccgagcaacgtccgcgtcaaagccgacttcgctgttacattccagtgg gataaggaggaatataaggacttcgagcgcgttatagtgaagataggctatcccagggagctccatcatctcgttgggcc aggagacgcgaagttcacgctgaggaagagaggaaaacacaaggggcagaacggaaaactgctcgtggttggtggaagct caagctattacggcgcaccttacctcgcctccaaggcagcctcatatctcgtggatctcgtttacctcgcgatgcctgct gaacctgcgaagaggataagcgaccctgacttgatcctcagacccttcctgggtgagaacttttcgccggagcacatcaa tgacctgcttgggcttgccgaaaaggcggacgccgtcgtcatcggccccggaatcggtctcgccaaagagacaaaggaat tcgtgcgggagttcgtaaagcgctgtgaaagaccgatggtcatagacgccgacggtctcaaagcggtggccgaagacttg ggcgttctggaagggaaaaccttcgtcctaactccccacgctggagagttcaatattttattcggtgtcaaaccccctga ggggttgctggaacgggccgaactggttagagagaaggccctagaaatcggaggcgtaatccttctgaagggttcctacg acgtcataagcgacggaaaaacctggaagtacaacagaaccggcaacaccggaatgactaccggtggaacgggcgacgtc ctggcgggcctcgttggagccttgcttgcctttggaaactcccccctgaggtctgcctccgttggggcgttcctaaacgg cctcgccggggatatcgtaaaggaagagttcggagaaaacttcaccgcgctggagcttgcgaaaagagtgccaaaggcaa taaaatgggtggaggagttt TAATTAATTATCCCACCTTTCATAAAGAAAGGTTATCCCCAGCAAGGGAAGAGCGTAGG CCAAGAAGTAAGGGGAATTGGTTGTCATAAACAATAAGACTAGGGCCGGAGACATTAATACTATATAGCGCTTGGAAGAG TAGTTGGAGTGGTAAAGCACGTTCACAAACAGTATTGCAACGAGGAAAATGAAAAATGACGATACCCAGAAGACAAACGA TGAAACACTCAACATGAGATGGTATGATATCGGTATCAAATAAGGAGCTACTACCACGGAAGACAACTCCCTTTTGTATG CTTTGACTCTTTTACCTGTAATCCCCACGAGCTCCACTGTCACCCATAGGGTCAATGAGAGCACTATTGCAAGAACATCA CCGTTGGAGCCATACTTTGCCGCTGTTACCATTAGGAGCCATAAGAGACCCGATAAAATCAGCTTCCAGCTTTTTTTGTC TTCCTTATAGTCCAGAGCAGAGATCAGTACAATCGAAATTA