

>tg0246 formate hydrogenlyase I subunit D (Mhy1D)

>tg0246 formate hydrogenlyase I subunit D (Mhy1D)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 233400 - 236391 (Additional range around tg0246 is :500nt.)

>Thermococcus gammatolerans EJ3 ACTCCTCGGACACGACGTCGGCCTGCAGATAGCCATCTACCAGGTCGTTAACCACGCCTTCGTAAAGGCCCTCGCCTTCA TGAGCGTTGGTGCCTTCGTGTACTCCCTCGGAACGACAGACCTCAAGGGCATAAGAGGAATAAAAAGAAGCCTTCCGTGG GCCAGCGTTGCCTGGTTCCTGAGCTTCCTCGGATTGGCCGGTGTTCTTCCGCTCGGCCTGTTCTTCAGCAAGGCTTTCAC AATCATGAGCACACGCGAGATAGGGGGCATTGCCTCCTGGCTCTTCCCTGCGGTAGTTCTCTTCGATGCGGCCATCTTCC TCGTGGTTGTCCTCCTGTGGTTCAGGGAGATATTCTTCGGTGAGCCAGAGCCAAGGGCAGAAACGGGTGAACCAAAGCTC ATGATCGCTGCAATGGTCGTTCTGATACTCATAGGCATCGTTGCCCCGTGGATAACGCTGGACGTTGTCATGAAGATAAG CTTCATGGGGTGATGAAAA atgttccttgagtacgctatcatagccttcatcattggcggtgtgataggcctcgttagg gactacagggtaagtgtgaaggcctcgagcttcatggcgttcctggggtcactcgcactcctcggtgaggtctaccacgt ctacaccaacggtccagagatgttcagtctctttgggatccccatgaacgtgagcggtctctcaaacgtcttcctgctga tcataggcatagtgggcgtcgcggcttcgctattcgcgatcaattatatggatctctttgagaaaacgggaaagggctgg gtgtacgcgatagcctacaacacgttcctcgccagcatgacactcgtcgtcaccgttgacagcatggagtacttcgttat gagctgggagctaatgacactcagttccttcatactagtcttcttcagcgagaaagcgagggacgtcaacgcgagcgtca agtactacatcaccatgcacttcctcgacacgatcccgctcttcctcgccctcggaacggcgtactcacttatcggaaac ttcgaggagctaacgttcgagaacataggggcggctctctccacacaccacacatcacgtcttgtgtttgcaggactttt gatgatcgcattcactgccaaggctgggttattccccttcagcttctgggttgcagaaacctacagggcagccccatccc acgtttcggcaataatggcaggagctatggagaagatggcactctacggaatcctggcgcttgtatggaagacagcggga atcgagggagacgcaggcatcatcgtagccctcgcgggcatgatcacaatcacgtacgcaactctgtacgcgctcaggga aaacaacgccaaaagactgctcgcgtactcttcaataagccagatgggctatatatggctggggatcggtatagggatgg ttctcgttccaaaaggtggtttccttgggacgataggggcactcggagcctttgccggcctcttccacgccctcaaccac gccatattcaaggcctcactcttcctctcggctggggcagttgagtataggacgggaaccgttgacctcaacgagctcgg cggcctcggcaggaggatgaagttcacggccctagcggcactctttgcatcgctcgccataagcggtgttccccccttca acggcttcataagcaagtggctcatctacgtctcaggttacagttcctcaaatcccttgctcatatttggagccgtgtta gcggtcttcttcagtgctggaacccttgcgtattcaatgaaattctacggagctcagttcggcggtgagatgaagcgcta cgagaacgtcgaggaggttccggcgggaatgctcctcggccagtggatcctggcaggtctaaccctaatcattggagtgt tccccaggatagtggtcccaatcctcaacgagccgttcaacgcacccctcaccgagaacatttacagaataggcttcggc tcggtgctcttctcgccggtgatctttgtgatactcctcggcgcactcgcggctgccctgtacctgaccttcaagccaga gttcggaaaggaaacgaagccctgggactgcggttcaacagaaatagacgaggacgagtacaggacgaacgccgagggct actacaactggtacgagaagaagataggctctttctatcgcctcggcgactggttctacaccgttggagctggagtaatc cactacataaccagggcttacctctggatggcgagctacttcaccaaggtagtcgacaccccgtacacaaaggttgagac cctcgacgacctccgcgagagggagataatgaacatagacgaggaggccctcaaaccgttgctcagactgctcaggatcg tcaagaacgtcctgccaggaatgagacttggaactttcgtggtactgaccctggtagtcatcggggccgtgataggaatc ctgatagccctg TGAGGTGATGGAAATGGAGACAACGATCAAAGTTGGATTCGAGCTCGTTGGGATCCTCATCATCTTC CTCCTGCCGCCGTACCTTGACGGAATAGCGAGAAGGGTCAAGGCGAGACTCCAGTACAGGCGCGGGCCGCCGCTCATGCA GACCTGGTACGACCTCCAGAAGCTCTTCAACCTTCCATCCGTTAAGCCAACGAAAAGCTTACTCTTCACCGCAGCCCCGT TCCTGGCCCTGGCCTCTGCTATCTCAGCAGCACTGCTCCTGCCCTACGGGAACGTCATACCAGTGGACTTCGGCTTCAAC TTGGTGGTGTTCTTCTACGTAATCCTGATGGTCAGCGTCTTCCTGATCCTCGGGGGCCTGAGCGTCCAGAACGCCTTCAG CCACATAGGAGCTACCAGAGAGGCCCAGCTCATCCTAACGGTGGAACCGCTCATAGCCATTCTCTACGGCGTCCTTGCTT ACAACGCCGGCTCCCTTAACATAGCGGACATCA