

>tg0247 formate hydrogenlyase I subunit C (Mhy1C)

>tg0247 formate hydrogenlyase I subunit C (Mhy1C)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 235401 - 237834 (Additional range around tg0247 is :500nt.)

>Thermococcus gammatolerans EJ3 CTGTGAAGTGGCCTGTGAAATGGCTCACGGCGAAGCCCGCATCAGGGTCTTCGAGTTTCCCGACCTCTTCACCGTCCCCT TCAACTGCCGCCACTGTGAGAAGGCCCCCTGTCTCAACGTCTGTCCGACAGGAGCGCTCTTCAGGGACAAGGACGGAGCT GTTGCCTTCGACCCCCTCAAGTGTATCGGCTGTCTCATGTGTGCCGTAGCCTGTCCATTCGGCGTCCCCAAGCTCGACGA GGAGAACAAGATCATGGACAAGTGCGACCTCTGTGCCGACAGAAGGGCAGAAGGTCTGCTTCCAGCATGTGTCTCGGCCT GCCCAACTGAGGCCCTTAAGTTCGGCGATGTGAACGAGATACTCTGGAACAGGGAAGGAAAGGTAGTTGCCAATCTGAAG AGCTCGGCCGAGAAGGGAGAGGGCGAGAAGGCCTACGTCATCCTCTGATTAATTTTTTTCAATGGAAACCAAGGGTTAAA AACCAAGGGGTGGTGAAAA gtgaacggcaccgtgttcatagtctcggcactcttgcccttcctgttgctgctcatatat aggacggagggcagaaccgccgatggcctcgcaatcctgataactggccttacactggcaataaatggctttggggccta cgccttctttggatccggggctgataaggtttaccacttctcctacgcctccgggaacaagctcggggaggtattcggcc tcaacgttgacgtggcatcggtcttgatgggcttcgtttcgatactcaccgcattcctgctcgtactctacgcggccgac tatctgggaccctcgaacaggggatttcccctcaacgaaggcaaggggcgcttctacgcactcctcggactgctcgtggg ttcaagcatggcgttcatatactcaacgaacctggttcagttcgccatcttccttgagctgatggcggtggcgctgtttt acctcgtgaacttccatggaaacgcggaaggaaaggcattgaaggcattcctcgtcctgaacctcggcgttttcctcctg ctgctctcgatcgtccttctcggcaacgggcaagaacttgcaaatatgggctcgctctcccagtcaacgaaggacaaggt cttcgcgattctcaccttcgcggccttcgcgatgagctcgcagttcttcttctactcgtggcttccggatgcaacggcag ggcccgttccggcatcagcatacatccacgcggcttcagtagttccgctgggaagcttcatgctcttccgcgttatccag tacatgaacccaggcaggggcgacttctggctcctgggagcgctcaccgtggcgctgatacttctcatgatgatatacta cccgctccagcgcgacgccaagaggctcatagcctattccacgataggccagacgggcgtttcgtacataacactggcct acgcactcctcggacacgacgtcggcctgcagatagccatctaccaggtcgttaaccacgccttcgtaaaggccctcgcc ttcatgagcgttggtgccttcgtgtactccctcggaacgacagacctcaagggcataagaggaataaaaagaagccttcc gtgggccagcgttgcctggttcctgagcttcctcggattggccggtgttcttccgctcggcctgttcttcagcaaggctt tcacaatcatgagcacacgcgagatagggggcattgcctcctggctcttccctgcggtagttctcttcgatgcggccatc ttcctcgtggttgtcctcctgtggttcagggagatattcttcggtgagccagagccaagggcagaaacgggtgaaccaaa gctcatgatcgctgcaatggtcgttctgatactcataggcatcgttgccccgtggataacgctggacgttgtcatgaaga taagcttcatgggg TGATGAAAAATGTTCCTTGAGTACGCTATCATAGCCTTCATCATTGGCGGTGTGATAGGCCTCGT TAGGGACTACAGGGTAAGTGTGAAGGCCTCGAGCTTCATGGCGTTCCTGGGGTCACTCGCACTCCTCGGTGAGGTCTACC ACGTCTACACCAACGGTCCAGAGATGTTCAGTCTCTTTGGGATCCCCATGAACGTGAGCGGTCTCTCAAACGTCTTCCTG CTGATCATAGGCATAGTGGGCGTCGCGGCTTCGCTATTCGCGATCAATTATATGGATCTCTTTGAGAAAACGGGAAAGGG CTGGGTGTACGCGATAGCCTACAACACGTTCCTCGCCAGCATGACACTCGTCGTCACCGTTGACAGCATGGAGTACTTCG TTATGAGCTGGGAGCTAATGACACTCAGTTCCTTCATACTAGTCTTCTTCAGCGAGAAAGCGAGGGACGTCAACGCGAGC GTCAAGTACTACATCACCATGCACTTCCTCGACAC