tg0258

Coordinates:245925-246248

>tg0258 Nucleotidyltransferase
MPVIPREELLEILREVKERLRDILGDDLVEVILFGSYARGEAREDSDVDVLVVVRRRVTLEEYDRLSEITEKYVLEKGLV
ISLIVYPISPGMEHDPLIQNVHVEGIKV

>tg0258 Nucleotidyltransferase
atgcccgtaatcccgagggaagagctcctcgaaatcctacgcgaggtgaaggaaaggctgagagatatcctcggcgacga
cttagtcgaggtcatcctcttcggctcgtacgcgaggggtgaggcaagggaagacagcgacgttgacgttttagtcgtag
tcaggagaagggtaacactcgaagagtacgacagactcagtgaaattacagagaaatacgttctggagaaagggttagtt
atctcgctcatcgtttatcctatcagtccgggaatggaacacgacccgctgattcagaacgttcacgtggagggtatcaa
agta


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 245425 - 246748 (Additional range around tg0258 is :500nt.)

>Thermococcus gammatolerans EJ3 AACGGATAGAGCGTATGGTTGAAGAAGAGATAGAGAGGGCCTTCGCCTCCGGTAGGGTGGATAGGGAGACGTACCTCCGT TTCGTCGAGACCTATAGCACTACCAAGGACGTTCTCCTCGAAAACGATGAGGAACTGCTCGCTGAGATGAGAAAAAAGGA AAAGGCGAGGATAAATGACAGTTATTGACACCAACGTGGTCATGAGACGAGTCAAGACAGGAGAAGAAATATCGGAAAAC ATCACGGAGGTCACTGCCGTTGAGTATCCTCCCGTTTTAAGCTATCGAAAGTTTAACGGAGAAATCCTCCTGATAACACG CAGGACAGTGGCGATAGCCATAGAGCTCCAGAGAAAGCTTAGAGAAATTGGAAAACCAAAGCAGTTCGCGGACCTTATGA TAGCGGCCATTTGTATAGCCAACGGCGAGAAGCTCATAACTTATGATTCCGATTTCAAGGACATCGCTGATGTTTCAGAA CTGGAGGTGGAGGTTCTCTA atgcccgtaatcccgagggaagagctcctcgaaatcctacgcgaggtgaaggaaaggct gagagatatcctcggcgacgacttagtcgaggtcatcctcttcggctcgtacgcgaggggtgaggcaagggaagacagcg acgttgacgttttagtcgtagtcaggagaagggtaacactcgaagagtacgacagactcagtgaaattacagagaaatac gttctggagaaagggttagttatctcgctcatcgtttatcctatcagtccgggaatggaacacgacccgctgattcagaa cgttcacgtggagggtatcaaagta TGAACAAATACGAGGAAATGCTGAAAAAAGCCCACGAGAGTCTTGAGGCGTCGA AAACGTTGCTGGAGAAGGGATTTTATGCCTTCGCGCTCTCACGGGCCTATTACACGATGTTCTACTGCGCCGAGGCGATT CTGCTGACAAAGGGAATAAGCGTCTCAAAGCACTCTGCAGTCATAGCACTCTTCGGCAGGGAGTTCGTGAAGACCGGCGA AGTTCCCCACAAGTTTTTCACGCACCTTCGCACCGCGTTTAATCTCAGACAGACCGCGGATTACTCCTTCGTGGTTGATA TAACCGAGGAAGAGGCGCGCGAAAACATAAGACGCGCCGAAGAATTCCTTGGATTTACGAGGAGCTACCTCTCATCGAAA GGCTTTCTGGAGGGTTGAAAATGGGTGAAAAGATAAAGCTCGAACACGGTGCTGGCGGGGAAATAATGGAGGAACTCCTG AGAAACGTCATACTGAAGACCCTAACACTGAAGAGCGCGGGTGGA