

>tg0261 Pyruvate synthase subunit porB (pyruvate oxidoreductase beta chain) (pyruvate ferredoxin oxidoreductase) (porB)

>tg0261 Pyruvate synthase subunit porB (pyruvate oxidoreductase beta chain) (pyruvate ferredoxin oxidoreductase) (porB)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 247226 - 249227 (Additional range around tg0261 is :500nt.)

>Thermococcus gammatolerans EJ3 GAGAACGCGAGGAAGGTCATAGATGAAGCCTTTGCCGAGTTCGAGAAGCGCTTTGGTAGAAAGTACCAGAAGGTCGAGGA GTACCGCACAGATGACGCCGAGATAATCTTCGTCACGATGGGCTCACTCGCCGGAACCGTCAAGGAGTACGTTGACCACC TCCGCGAGAAGGGCATCAAGGCCGGAGCGGCGAAGCTCACCGTTTACCGCCCGTTCCCGATTGAGGAAGTCCGCGCTTTG GCTAAGAAGGCCAAGGTTCTGGCTCTCCTCGAGAAGAACGTCACCTTCAGCGTTGGAGGAGCCCTCTTCCAGGACTTCAG CAGGGCCCTGATAAACGAGAAGGAGAAGCCGATTATCATCGACTACATCGTCGGTCTCGGTGGCAGGGACGTCACGTTCC AGAACCTCGACGAGGCCCTGGCTATAGCGCAGAAGGCCCTCAATGGAGAGGAGTTTGAGGAGGTCAACTGGATAGGCCTC AGGAAGGAGATACTGTGAG gtgatgaagatggccgttaggaagccccctatcacaactcgcgagtactgggcgcccggt cacgccgcgtgtgccggctgtggctgtgcaatcgctcttaagctcgccacaaaggccttcagcgaggctatggaggaaaa gtacggcgacccgaacgccttcgccatagcccaggccacgggatgtatggaggtcgtttcggcggtcttcccctacaccg cctggaaggttccatgggtgcacgtagcctttgagaacgcggccgccgccgcgagcggtattgaggccgcctggaagaag aagggactcaagggcaagatacttgccataggcggtgacggtggtaccgccgacataggccttcaggccctcagcggtat gctcgagaggagacacaacgtcgtttacctgatgtacgacaacgaggcctacatgaacacgggaattcagcgctcaagct ctaccccctacggagcctggacgaccacctcacctcccggcaagtactccatcggtgaggacaagcccaagaagtgggtc gccctcattgctgcggcccaccaggttccatacgtcgccaccgcgagcataggcaaccccttcgacttcgtcaggaagat gaagaaggccgctaaggtcgacggcccggccttcgtccaggttcactgtacttgcccgaccggatggaagagcccgctcg agaagggcgttgaaatagctaggctcgccatcgagactggaatatggccactcttcgagatcgagaacggcgacttccac aacatcaagatacagagcccaggaggaggcgcgaaggtcaagcgcgagggaggcaaagtagttgccatcgagttcaagaa acccatagaggagtaccttaagttgcagggcaggttcaagcacctcttcaagaggccagaggcaatcgaccagctccgcg agcagataaaggccatgtggaaggtcctcggcgtcgaggtcacgcttccaaagccggaggag TGACCTTTCCATCCCCC TTTATCTGTTTTTCAGAAAATGAAAGCAAAAAGCCCAAAATCACCCGGCTCAACATATCCTCGGCACGGGGTCGCCTTCG GGCGGCTCCATAAATCTCTTTCCGCCGATTCCGGTCTCTAAGAGAACTTTCCCCCTGTATTCTTCTATTACCTCCCCTAT TATCGCCGCGTCTTTCCCTCTCTCCGTTTTCCTCATTGCCTCAAGGGCTTCCTCCGCATACTCCCTGGCGACGACCATAA CCACTTTCCCCTCGTTCGCAACATCGTAGGGGCTGATTCCCAACATCTCGCTCGCGGCCCTCACCTCGGGCTTCACGGGT ATTGCATCTTCCCTCACGAGGATTCCGACGTTGCTCTTACGGGCAATCTCGTTGAGGGCGTTGCTAAGCCCGGCCCTTGT CGGGTCCTTCATCGCGTGTATATTTTCCCAGCCAATGGCCTTGGCGACGGCTTCAACGACCTCCCATATGGGAGCTACGT CGC