

>tg0275 Prokaryotic ATPase, AAA superfamily

>tg0275 Prokaryotic ATPase, AAA superfamily

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 259318 - 261715 (Additional range around tg0275 is :500nt.)

>Thermococcus gammatolerans EJ3 GTGAGTTGCTTTAACCTGCGCATCATGATGATGTAGGGATGATAAGCGCTCTGGATTGCCCTCAGGGCGGAAGGCTCCCT TCCAGTGTAGCTTTGAGGTGAACCGACGCTCGGCCCACCGGGACAGTAGATGCATCTGCCATGAGGGCAGGGAAATGGCT TCGTCATCATGGCGACGACGGCGACGCCGCTTATAGTTCGGGTTGGCTTTCTCTTGAGCAGTTCCCTGAACTCCTCGCGC CTCTCCTCTGGAATGGCCTTAAGAATGTCCGAGTTGCCCGGAATCTTTGAGAGGTGATACTTTCTCGCCACCTTAATCTT CCAGCGGTTGAGCTCGTCCCGGCTCTTAATCTCACCGCTCATGACCAGTCTCGCCAGCTCGTTAACGGCCTTTTCAAACT CCTCCATGACAACACCTCTCGCTCGATGTAGGGCGGAGTTTTAAAAGGTTTGCCGGAAAGTTTATATTCACTTAGTGAAT AATTCAGTTGGTGAATAAA atgcgcttcatcaacagggagcgcgagatggagctcctcctgaaggctaaggaacgctct aggagaaagctctacagcgttgccatctacggcctcaggcgggtggggaagacgagactactgagggagttcctgagtga aaacgatttgtacttcttcgtgaaccggggcaaaagctccgccttgctcctgagggagtactcggaaatcctccggggaa aaggcattctctccaaaagagaagagctcaaaagctgggacgacttcttcgaggtcctatttgagcgtttcaccggcgcg gtggctttcgatgagtttcaggactttcgcttcgtcgagccttcagtctattcaacgcttcagcggttcatggacgaaaa tgaagagaaacccatgctccttatcttcacaggttcaacaattggaatggtagagagactcttcaaggactccaaagagc ccctctacggaaggataaagcgggagcttcgcctagagcctctcgacatcaggggaagctacgagatggcgagggaagtt ggaatagagaaccttgacgacttcataacgctctactcggttttcggtggctttccccgctactgggtggccgttgagga cgagggtcttgagggggagaacgcggaaaggattcttaaggagctaatcttcagctattcggcgcccctcgaagaggagg tccccaggatactctcgctggagttcgggaagcgctcgggggtttattacgacatccttgaggctatagccaacggctcg acatcgccgagcgagattgccggctacctaaacagaaaggagacctcgataacgagacagctccacgagctggtgaacta cttcaagctcgttgactacgatagggcagttttgggaaagggaagcgttctctacataaggcatcccttcctgaacttct ggttccgcttcgtccagccgaggctgagcgagtacgaattgaacagggagaggctatgggaagatgttaaaaggaatctc ccggactacgttggcaaaaggttcgacttcgcctgcagggagctgttaaggctcagcggaaactttctcccattccaacc gacagttataggaagacactggggccgttacagagaaggcgggaagaggaaggtctacgaaatcgacatcattgccctgg actccgaggggagaaaagccatttttggagagtgcaaatggagaaagaggacccagaacgctgagaagctccttgagaaa ctcagagggaaggtagaactcaccggctggaggggagaggtttattacctcttaatcgcaaggaagctcaggaacgttcc ggaaaacgttatagcccttgatgaaaaaggtatcaaaaacctgctggagggagagaaa TGAACCGCGACGAGCTGGTCG CTTTCCTCGACGAATACCTTCAGATTTCGGCGTACCCCGACAAGTCGAGCAACGGCCTCCAGGTGGAGGGAAAGGAAGAA GTTAATAGGGTAGCGTTCGCCGTTGACACGACGCTCAGAACCATCGAGAGGGCCGTTAATGGAAAGGCCGACATGCTGGT AGTCCATCACGGAATGATTTGGGGCGGTCTTAACTACATAACAGGTATCCACTACAAAAGGCTGAAGGCGCTAATCGAGA ACGGCCTGAACCTCTACGTGGCACATCTGCCCCTCGATGCGCACCCAGAAGTCGGCAACAACGTCGGCCTGCTCCGCCTG CTCGATTTAGAGCCCAAAGGGCCCTTCGGCGAGTACAAAAGCCTGAGCATAGGCTTCTACGGCGAGTTTGAAGAACCTCA GCCGATTGAGAAAGTTGCCCAAATAATAGCGGAAAAGCTCGACACAACAGTTAGAACCTACGAGTTCGGGAGGAGAGTT