

>tg0286 Acetyl-CoA synthetase (ADP forming), alpha chain (acdA)

>tg0286 Acetyl-CoA synthetase (ADP forming), alpha chain (acdA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 269352 - 271962 (Additional range around tg0286 is :500nt.)

>Thermococcus gammatolerans EJ3 CGGTTCTGTATACGTTTCCATCTCCAGCAGACAGGGCCAAAAACGTCCTGATATGGGAGAACGCCGACTACCTCCCCATG ATCGGGGTCTCCACCGGGAGCCCCGGCGAGGGAACCAGCAAACCCCTCTCCTGCAACCCCCTCAGGATAGAGCTCCACTA TTCACCGGAGGAGGGAAAGGTGTTCTTCAACGCAACTTACATGTGTGAAGCCGGTCTCCCCGCACTGCCCGGTGCCAGAA ACGTGACCTACATCAAAAGGGGCAACGTCACGGAGGTCAGGGGCTACTTCGTACCCAGGCTGGAGTACGATGAGGGACTC TTCCGGAGGGAGTGGAGGGCGGAGATAGAGCTGCCCGAAGAGTTCCCGCAGGTGGTGGGTGGATCCCGGGGGAAAAACGG AAGCATCGTTATAACTGTGGAGAGATCCTCCGCGGGCATTCAAACTGCAGTTCCCGTAATCTTTATCGCGGTTATCATAG CACTCTGGAGGTGGAAAAG atgagccttgacttctttttctatccgaggggtgtagcggtctttggatccttcagaaag ggtgcaatcgcctacgagatacttagaaacatcgtcgagggagggtttgaggggaagattatccccgtgaacccaaaggg tggaagcgtcgaggtcgcggggagagtctttgaaatccgtgagaggcttgacgaacccgtcgataccgccataatcgcga ttccggcaaagttcgtgccgggactcattgatgaaatcggcccccggatcaagggcgccgtagtgataagcgccggcttc tcggaggttgggaacgctgatctcgaacgcgaactggttgaaaaggctaggaagcacggcgtcagactcataggcccgaa ctgcgccggaatcttcggcgttcacgggaagttcttcggctcctttgaggttagggtaaaacccggcgggttggctttaa tcagccagagcggagccttcggcggcgcggctttggcaatgggcaacgaagagggcatcggcttttcggccttcgtctcc tacggaaacgcggcagatctgaacgagagcgactttttggagtactttgcggacgatgagaacacgaaggcgatagcgct ttacattgaaggggttaaagacggcagacacttcttgaaggcgctcagctatgcgagcaagagaaagccggtcatagttc tcaaggccggtaagagtgccagtggagctaaagctgccgcttctcacaccggctctctagccgggagctacgagatttac agggccgccttcaagcaggccggagctatcgaggtcgaggagatggaggagctcttcgacgccgctaaagccttcgagat gtattcaatggccgggaagagggtggccgtaatcacgaactccggcgggcccggtgttctggctaccgacaagctggaga gactcggccttgagattgcaaagctgagcgaggacaccgttgcgaaactccagtccttccttccagagcagtgctccacc agaaacccgattgaccttatcgcagatgcggactacgagcgctataaaagaacgattgaaattgtctgcagggacgggaa cgttgattcaattctcgtaatctgtgtcccccctattttcatcccaagtgaggagatagccaaagccgtaatagaggcgg actgcgacaagccggttatagttaacttcatggccggtgaactcgttcgggatggtgtgaaactgctggaggagcactcc ataaagaacttcccaactccagaaagggccgcgagagctttggcatggctcgcaatgaggaaaaaaagagggggattaat cctttttccccaccctctcaaagagctctttcacctcgtcaagggccccggttttggcaaaaactatgagcgaaccttcc tcgggaagcttggtatcgccggagggtattatgaggttgccctttttgtcgtagacggcaacgatgagagcatcctttgg gaggttgagttccctgacggttttcccagcgacccagctctggggagttatctcaaagcgaactatctcggccccttccc tcgggaaaagaaccctgtcaaaaccgggggt TGAAATGTTGCGTGAGATGTACTCCGCCGCTATTTCCTCGGGTGAGAT TATAAAGTTGAAATACTTCTTGAGATCCTCAACCCTCTCGAAGATCCTCTTGTTCTTGGGGTTGCTTATCCTCAGGGCAG TATAGACGTTGGGGTTGAGGTTCTTGGCGAGTATGCAGGCGAGTATGTTGGCGTCGTCTTTCCCCGTGAGGGCGGCGAAT GCGTGGGCCTGCTTTATGTTGGCCTCCTCAAGGGTTTTGGGGTCGGTGGCATCGCCCATTATCACCAGACCGTTTATCTC AAGGGAGAGATCCTGGGCCCTTCGCCGATCGAGTTCAATAACGGTAACGTCGTGGCCGTCCTCCTCAAGCATCTTGGCCA CAAGATAGCCGACCCTCCCGGCGCCCATTATCACAACGAACATACACATCACCACCGCTGAAATTGAAAACGGAAAAAGA AAGGGTCACTCAAGCGAGAGCAGATACTTGGCTATCTCCGCGTAGGCTGGCC