

>tg0326 TRP-repeat-containing protein

>tg0326 TRP-repeat-containing protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 307600 - 309616 (Additional range around tg0326 is :500nt.)

>Thermococcus gammatolerans EJ3 GAGAGGTTTGGGGTCAACGGGAGAGACATTTGGATTGGGGTAATCTTTCACGGCAGGATTCAGGGGATAAGCTTCGCCTT CACGAGGGGCGAGCTTTTGGAGAGAATCAGAAACCTCGCCGAATTCCTGCGGGGAAGGGACGTTAGAGTTTCCCTCGACG TCCAGCCGAGCAACTACACCGAGCTCGTCTACCGCGTTCTCATCGGCGAGTTAGAGAACGAGAAGGCTTTGCCCGAGCTC TCCTTCGAGGGCGTAACGCCCTTTGAGAGGCGCGTTTACGAATGGCTCACGAAAAACGTTAAAAGAGGCACCGTTATAAC CTACGGTAGCCTTGCGAAGGCCCTTGAAACGTCGCCGAGAGCGGTCGGTGGGGCGATGAAGAGAAACCCGTATCCAATAA TCGTCCCCTGTCATCGGGTTGTCTCCAGAGAGGGCATCGGCCACTATAACCTTGGGATTGAAGAAAAGAAGTTCCTGCTC GAACTTGAGGGGGTGAAGGA atggacaggctgaaggcttacataataggcttcctgatagctgttctggcgatagcggg cttcatagtgtacgaatggggatgggttaaactgctacagttaatcctcgcggtaggcttcgtaggtttcacgcttgcac tgctgtttttcacggcgctgaccctttacgccgagagctggaagtacggggccattctggcagtcctcaccgcgatagcg ggctacggctcctacctcgtgctcacctggcagaagctggaaatcgttggaggaatcatagcgttcttcatcctgctctt cgccttcggaatctggtatataagcgagcccgatttgagcatagcggaccgcttccgctcggctgaaaagcttgagagga tgggacgctacaagcaggccgcgaggaaatacgagaaggccggaaactacgagaaggccgccgagatgtacctcaagctc ggctggcttgagagcgcggcgtgggcctacgagaaagctggaaagtacgagaaggcagctgagctctacgaaaagctcta tgagaaggagaaggacacctactacctgaaggaggcccacgagtactggaagaaggcaggaaacatggagagggccgcca gggcgcttgaaaagtacgccgaggaggagccctggttctgggaagatgttgccaagctctacgaagaactaggaaacgag gagaaggccagggaagcctgggagaaggcccttgagtactacaccaaggaggcccaggaggagggcgtcttctgggagga cgtcggcaacatagcgaggaagctcggaagggaagagctcgcgagagaggcctaccagaagttcctcgagtactgcctca aggaagctgaaaatgacccgatgtggtggaagcacgtggctgaggcctacgagtacctcggcgagaaggagaaggcagaa gaagcgaggaagaagtacgaggagtacaggcagagaatccttaaggccaacgaggagacctcacaattccctgagaat T AAAGGGGTTGACTTTCCTTATATTCTTTGGTACCCTCGTTACCCGCCGCTCCTGAAGCTGGCCTTCAGGGGGTCAGTAAA CGTCTCCAGAGTCTTCGAGCTCCCTCAATTCCTCCTCAATTTCCTTCTCTTTCCGTTCGGCGTAGCGCTTGAGGTAGTCC GCGAGAACGTAGAGCGCCACCCCGCCAAGGGCCGTGAGAAGAAACGCCGCCGCGAGGGTTCTAAGGGTTACGTCGCCTCC GGACGGTGGGGCATCGTCACCACCGGAGACCTTTCGAAGAAGGCCGTTAAAATCTTCCGCCAACCTTTTAAGAGCCCCCG CGAACCTTAGCTGGTGGTCAGGATGATGGGAATGAACCCGAGACAGATGAAGAAGCTCATGAAGCAACTCGGCATAAAGA TGGAAGAGTTAGAAGGCGTTAAGGAGGTTGTTCTCAAGCTTGAGGGCAAGGAAATAGTCCTCAGGAACCCCGTAGTTACG GTCATGGTCGTTCAGGGT