

>tg0328 hypothetical protein TGAM_0328

>tg0328 hypothetical protein TGAM_0328

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 309278 - 311792 (Additional range around tg0328 is :500nt.)

>Thermococcus gammatolerans EJ3 GAGAGAAAATGGAACAGAGTAGCGCTCGTTTCAGGGGGAATTGGCATTCCACCGCTCTACGCGCTTGTAAGGGCCTGGAG AAATGAGTTTGAGGGGATAACGCTAATCTACGGCGCCCGCTCGAAGGAAGAACTGGCCCTCCTCGATATCGAGGACTACG TGGACGAGGTTGTAATCACTACCGACGATGGCTCGGCCGGCAAAAAAGGCTTCCCAACGGACGTTTTGGCGGAGAGAAGG GGAGAGTTCGATGGGGTTTACGCTTGCGGTCCAGAACCGATGCTCAAGGCTGTTCTGAGGATCATGGACTACGAAAACGT CCAGGTCTCGGCGGAGCGCTACATGAAGTGCGGAATTGGCGTCTGCGGTTCCTGCAACCTCGGGAAGTACCTCGTGTGTC GTGACGGTCCAGTGTTCGAGGGAGAAAAGCTGAGAGGGGTAATGTAACAACCGAAAGCTTAAATCATAAAGGGCCGTAAA ATGAATCCGGGGGCCTTCA atgcagaaggaagaagtgataatcgaaaaaagtggcattagggaggatcttctctcctgg aacataaaagaagttgtcgctcttgccgagaactatgacgaagcgttccatattgttaaggaacttttaagggacaagaa ccccatcgtgaaaaccaacgcgcttcaggtcatcaaggagatgataaagaggggcacgctggatcggaggaaggtaaccg aggtggtagaggatatcgtggagctcgccaaggacaaggacgagagggtctccctcaaggctatagaggtcctcaacctt ctcctagagaaggaggaactggacgagaatcagtacgagcttgtcaccgatgcccttatggacataatcaagagaggtgc ccccctactaagtgagtacgcttcagaaggtcttggaaaagcaggtgctaaagtcctcaaactggcaagaaaattaatag gatggctgttctcccttataaaatcttcaaaggatagacaggttcagagtgctgctatcgccgcccttaccgagatggca gcgagaacggaggataagaggatattcaacgagatctttgacaacatggccgatcttcttgatcacatcgatccatacat tcaggagagagccctcctcgcgctcgacagaatgctttccagagcggaaatactgacgaagagaaataagataaaggcca tgaaaaaaatcagagagatcagcaatgacgttcgccttgcttcaaaggcaagtctgatcctcgagaagctggagaagata agcggagaggaagaagaaattctaaccaagcaagaactcaagaaaaagctggagataagtgaatacgggccggatgacgt tgaaagactccttgacgccggtaaaactgatatcgtagccgagctggcaaagatagatccgatagtcatgtcgatgatcc tggaaatgctgcactccgacgatcccgtgaggagaatggacgccctctgggttctctcaaaggtaacctcccagctaaca ccaacggacgcttactcagtgcttcccgttcttgcggaattcctgaagagcagaaatccctgggcgagaaaaactgccgc ggaaacgatggccgacatatattcgctctatcccggaaccgcacagttcttcacgtcacttcttgatgttctgcttagat cctccagagatgcagacgttgagggagctctcgagctgatattttcccttcagcaccgtctcccaacgccagagttcgag atggcaatggtctcaatactctcagacctcctccggaggaaggaaacgagggcagtgacgctgcgctttatggccagaga ggcccagaggcttatggattttgactacgaggggcttatccagctggaaaatgccctaaaggaaatctacggggatgaag gtgggaagtacgacaacataatcgcctcgctgatagacctcatcgaagacctcataaaactcaagaaaaaggagtcagga tccctcggtcagctg TAGTATTGCCTCCGCTATGTCCCCTTTCGTTTCTTTCAACGCTTTTAGCGCGGTTTCCCTGTCA ACGCCGGCCTGCTCCATGACGAGCTCGATGTCCTCTTCGGGAATCTCAATTACCTCCCTTACCTCCTCACTCCCGGGGAC AATCTGATAGGTCTTCTCACCCTGAACGACCATGACCGTAACTACGGGGTTCCTGAGGACTATTTCCTTGCCCTCAAGCT TGAGAACAACCTCCTTAACGCCTTCTAACTCTTCCATCTTTATGCCGAGTTGCTTCATGAGCTTCTTCATCTGTCTCGGG TTCATTCCCATCATCCTGACCACCAGCTAAGGTTCGCGGGGGCTCTTAAAAGGTTGGCGGAAGATTTTAACGGCCTTCTT CGAAAGGTCTCCGGTGGTGACGATGCCCCACCGTCCGGAGGCGACGTAACCCTTAGAACCCTCGCGGCGGCGTTTCTTCT CACGGCCCTTGGCGGGGTGGCGCTCTACGTTCTCGC