

>tg0334 ABC-type dipeptide/oligopeptide transport system, ATPase component (dppD/oppD)

>tg0334 ABC-type dipeptide/oligopeptide transport system, ATPase component (dppD/oppD)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 318147 - 320103 (Additional range around tg0334 is :500nt.)

>Thermococcus gammatolerans EJ3 CAGCATACCGTCCCTGCCTATCCTCATCCTCATAGGAGCAACGCTGGGTCACATAAGGCTCTCCCTCATAGTGGTGCTAC TTGTGGTCTTTGGATGGATGGGAGTGGCTAGGATTTCGCGCAGTATGGCACTGCAGATCAAGGAGCAGACGTACATTGAG GCTGCCAAAGCTCTCGGCGCCGGGACGGGGAGGATAGTCTTCAAGCACATCCTCCCGCAGCTCTTGCCCTACGCCTTCGC GGTTATAGCCCTGGGTGTGCCCGTAGCGGTCATCAGTGAGGCATCCCTGAGCTTCCTCGGCCTCGGCGATCCAACTCAGG TTACCTGGGGACAGATACTTCACGATGCCCAGATGAAGTTCGCGGCGACGAAGGGCTACTGGTGGTGGGTTCTTCCTCCT GGGCTTGGAATAGCCCTAGTTGGCCTGACCTTCGTCCTGATCGGTACGGCGCTTGATAGGATACTCAACCCGAGGCTTAG GAGGCTGTGAGGTGATTTAA atggcaaagaacatcctcgaggttagaaacctgaagatgtattacttcacgaacagggg tatggtccgtgccgtcgacgacataagctttgacctcaaaaaaggagaagtcctgggacttgccggtgagagcggttgcg gcaagtcctcccttggttttaccctcatgggaatgccaacccctccggggaagatagtcgacggaagcatcaagattgac ggcagggaaatcgttggtcttccggaagatgtcctcaggaaggagatccgctggcagaagatttcgatgatattccaggg agccatgaacgcccttaacccagtttacaccgttgggtaccagatgatagagcctttagtcctccacaagggtatgagca aggacgaggccctggacagggctcagaaataccttgagctcgtaggtctcgaccccgagatcgtctaccgctacccacac gagctgagcggtggtatgaagcagcgtgtcattatagcttccgccctcctgcttgagcccgacgttgtcattgcggacga gccaacaacggctctggacgtcgttgttcaggcccagatcataaacctgatgaagaagctgaagaaggatcttggcctct caatgatattcatcacccacgacctcagcatcttggctgagatcagtgacaaagttgccatcatgtatgcggggaagatc attgagatcggcgacagtgagaaaatatactacgagcccgctcacccgtacacacagaaattactcgcttctattccaag gctccatgaggacgttgaaaagctcgagttcatcccgggacagccgcccaacctcattaacccgccgaagggctgccgct tccacccgaggtgcccctacgcgatggacgtttgtaaggagcaggagcctgaactgaaggagattgataaggatcactat gccgcatgctggctgctg TGAGGTGTGAGAAATGGCCGAGCCGGTGCTTAAAGTTGAAAACCTTAAGAAATACTTCCCG ATTAAGAGGAGTTTCATCGATACCCTCAAGGGTGCTCCCCAGAGGTACGTCAAGGCCGTTGATGGCATAAGCTTTGAGAT AGGGAAGCAGCAGGTCTTTGCCCTCGTCGGTGAAAGCGGCTGTGGTAAATCAACGACAGGAAAGCTCATAGTTAAGTTAC TTGAGCCAACCGACGGGAGAATATACCTTGAGGGGCAGGACGTTACAGACATAGTCACAAAGGAGGAGGTACTGGCTTAC AGGCGTAAGGTTCAGATAATATTCCAGGATCCCTTCAGCTCTATGAACCCCCGTTTCAGGATCTTTGATATTCTCGAGGA GCCGCTTCTCATCCACGGTATCGGTGAAACAAGGGCGGAGCGTGAGGAGCTGATCTACAAGGCCCTTGAGATGGTTAAGA TAACCCCGCCGGAGGACTACGTTGGCAGGTTCCCGCAC