

>tg0343 DNA primase small subunit (priA)

>tg0343 DNA primase small subunit (priA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 326676 - 328698 (Additional range around tg0343 is :500nt.)

>Thermococcus gammatolerans EJ3 CCATAGGTTCGACAGGCTCTCAGCCCCTTCGGCCTGATCTATTTCCGCCCTGTATTAAGAAGGCACTCTCCGGCGTCAGC AGCGGAATGAGGAACTACGCCATAACGGTTCTCCTCACGAGCTTTCTCAGCTACGCCCGTATATGCCCAAACCCCCCTCG GAGGAACGTCAGGATTAAGGACTGCATTGGGGATCTGAGCATCATCGAGCGGGAGATACTCCCCCTCATCATCGAGGCAG GAAACCGCTGTAAGCCACCCCTTTTTGAGGACCAGCCGAACGAGATCAAGAACATCTGGTACCACTTGGGATTCGGTTTT ACGGAGAGACCGAGCCTCGAAGACAGCGGAAATTCAACGTGGTACTTTCCACCGAACTGCGACAAAATAAGGGCGAACGC ACCCGCACTGTGCAAACCGGACAAGTACTGCAGGGGCATCAAGAATCCCCTGACGTACTACCTCAGGAGGCTGTACCTGG AACGCAAGGAGGGTGGTGA atgagcctgtttcgggaggtcacgccagaagaaagaaaggcctactaccagagggaatgg agcgcggaaatgctgccagacttcatagtggaaacactcgaaaacagggagttcggctttgaccacaccggggaaggccc gagcgacaggaaaaacgagttcagcgacgtaagggatctggaagactacgtaaaggccaccgctccctacgccatgttct caagcgttgcactctacgagaagccctccgagatggagggatggctcggagccgagctcgtctttgacatagacgcaaag gacctgccccttaggaggtgcatggatctgcaccccagcggccaggtgtgtcccctctgccttgaggacgccaaagaact cgttctcgacactctcacgatcctgaaggaggactttggattcgaggagatccacgtggtttactccgggaggggttacc acataagggtgctcgacgactgggttctcgatcttgactccaaggccagggaaaagattctggcctacgtcagcgcggcc gaggagataacgtttgaggacgtccagtcccggaggataatgctctccgcgggctacttccgggtgttcaggcttcgttt cgggtactttctcaggaggataaacctcaaccacctgctcaacgtggggatcaaaagaagacaggcggaggccattctcg aggagagggatgagatctacgagggctttgtgaggaaagccatgttaacagcatttccccagggtattggatacaaaacg ctcatgaggctcttctcgttgtcaacgacgttctcacgggcatactttgacgggaaggtcaccatagacctcaaaagaat cctaagggttccctcaagtctccactccaaggtggggatggtgacgacctacatcggcgacgacgagaggaagcttgaga agttcaaccccttcagagacgctgtccccgagttcaggaaggaggaagtgaaggaagcgtacgaggagtgggagagctca cta TGAACCGAGGAAAGGCACAGATAGCGCTTGCGATGCTTATATGGGGAAGCGTCGGAATATTCGGCAGGCTCTCGGG GCTTTCTGGCCTGGGCGTTGCCTTCTCCAGAGTTTCGCTTGGAGCGGTAGTTCTTCTTCCAATCCTCGGCCTCAGGGGAA AGCTCGGAAATGCCTTGGGGGAGCTGAGAAAGAGGCCGTATCATATGCTTGCGCTCGGGACGGCGCTGGCTCTGAACTGG GTCTTCCTGTTCACGGCCTTCAACCACACCACCATTGCAAACGCGGTCCTCGTTTACTACACCGCCCCGGTTCTGGCGAC GCTGATTTCGTGGCGCTTTCTCCATGAAAGGCTCGACGCGAGAAAGGTTCTGAGCCTTGCCATAGCATTTACGGGACTGC TTCTCATAGCCTCGTCTCAGAGAATCAGCCTCTCTGACAGGGATTTCATAGGAATTGTGTTCGCGTTTCTGGGAGCGCTC TTCTACGCCCTGATTCCGAACCTC