

>tg0384 ABC-type dipeptide/oligopeptide transport permease protein appB (appB)

>tg0384 ABC-type dipeptide/oligopeptide transport permease protein appB (appB)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 365667 - 367644 (Additional range around tg0384 is :500nt.)

>Thermococcus gammatolerans EJ3 TCGTCCCGCACAAGCCGACAGACCTCATCTGGTTCACCAGCGACAACCCGGGCAACAGGGTGGGCTTCTCCAACAAGACC TATGACGAAACCTTCGAGGAGTTCCAGAGGACCGGCGATCCGGCCCTGGCCCACAAGCTCGAGGAGATACTCGCCAACAA CGTCGTCTTCATAGCCCTCTACCACCCGATAGTCGCAACGCCCTACAGGGTTGACCGCTACAAGGACTGGGCGCCAAACC CGAGGTTCTTAACGCTTGGCTACTGGTCGCTCCTTGGAAACCCGGAGAAGCCAACGACCACAACTTCATCAGAAAAATCC TCCACAACGACGTCATCCTCAAAGACCCCCTCATCATCGACCTCAACCACCAAGAAAGGTGAGAAAGGCCTTTGTGGACC GGCGGCACTGGTGCTCTTTGCTGTGCTTCCGCTGTTGAAGAGGAGAAGGTGAGTCCTTCTTTAATTTCTTTTTTGACGAA CTTCTGGTGGTGAGCCATC atggcaaggggaatggtctcgtacacgctcgctaaaattgcccacaggcttctcaccctc atcttcgtcatccttatcatatacaccctcctaagacttgccccgggaacgcccttcgatcagtacctctaccagggaaa aataacggaagcccagtatgaggccctcctgaaggagtggggttacagggacagcttcctcgtgggggcagccaagatgc tctacggcatggccacgttttcgctcttcaagatgaaatcgccagtttacaataagcccataatcgatttgatatcggtt cgtctaccatacaccctcagcctcgttaccgccgcgtactttttcggtgccatgctcggaatgattttgggcctgtactg cgcccgaaacaggggcacgctcaaggaatctgccatcatctggataacccttggaataagatccctccccgtgttctggc ttggaatggttctgctttacgttttcgcgttcaagctcggcctcttcccgtttctaacctcatccgagcttcacccccgt aacgtgtttcatcacatgatagactggttgtggcacagtctccttcccatcatagccctctccaagatctacgcagtctc gtacctcctcacaatcaggaacatggtatccgaggaatacaccaacgactacgttgtctcatttcgtgctatgggcctac gggaagactacatcatcgagagatacgttctcaggagcataatgcccccaataatcacgatgatggcaatagacctcggc ttcctcttcggtggagccgttgtcaccgagacagtcttcaactatccgggcatggggacactgatatacactgccatctg gaacaaggattacccggtggttttggcctcgttttacataatagcggtcgccgtgatactcgccatcacgatagccgaga taacctacgcctacctcgacccgaggatcaggagggga TAAAATGGCAATGACCCTGAGGGAGAAACTTGAGGAGAAAT GGGAGTCCCTCAAGGAGGTCTCCGGCTACGTTTGGCACCACAAAATGGGTAAGGTTGGCGTAATAATACTCGCATTCCTC CTCATTATGGCCTTATTCCCGGGCCTTTTTACGAAATACACTCCAGATTGGACATCGGATGAAACATTCGTTCCAGCATC GTGGGATCATCCGTGCGGTATAGATCAGGAGGGAAAGGACATCTGGGCCCAAATAGTCTACGGAACGAGGATTTCACTGG CAGTGGGTTTCATCGCCGCCCTGCTAACCGTAACGATAGGGGCACTCGTCGGTACCGTTGCAGGCTATTACGGGGGCATC GTCGATGAAATCCTCGTCTTCGTATCGGACTCCATAATGATGCTTCCCAGTCTGCTGCTCTTGATAGTCATAGCGGCGCT CTTCTCCAATGTCTGGAACATATGGTACACGATAATCGTGATAGCCCTCATCGCGTGGC