

>tg0385 ABC-type dipeptide/oligopeptide transport periplasmic component appA (appA)

>tg0385 ABC-type dipeptide/oligopeptide transport periplasmic component appA (appA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 366695 - 369467 (Additional range around tg0385 is :500nt.)

>Thermococcus gammatolerans EJ3 GAGGGTGCTCTCAAGTTCAGGGAAACCCTCGGCCTTCCCAACGAGGTTTTTCCGGCACTCGAGTTCAGGCACGGACCGGT GGCATTGTTGCGAGGACCAGAGAAGCCTCAGCCCATCGTCATCGCACCGGAAGGTAGTTCAACCGGCGCGCTCAAGAGGC TTATCGACGACCTCGCATCGAGGAACGCAGAGCCGCTTGTTTTCACGAACTCGGATGTTTTCGAGAACTGCGTAAGGGTT CCTTGGAACGGGAGCGAAGAACTCGCTGTGATCCCATTCATAGTTCCAATACAGATAGTTTCCTACTACCTAGCCGTTCT TAACAATCTGAACCCGGATTTCCCCGAAGGGCTAGTTAAGGTCGTAGAAAGATTTTAAACATAAATCAAAATCTTTTATC AGCATTTTCTTTTTTATTAACAAAAAACTTCGATGAAACAAAAAATCTTATATATGCGAAAGGCGCATTAATAAACGAGA ATAGGCGGGAGGTGTCCCT atgaacagaaaggggctttcgctactgctggcagttttgtttttaagtagcatcgctgca gcgccaagagtcagtgcatcagcgggaacagaactcgtcctcgcggttggcaaatggaaaacgctgaacccgctgacatc aagcacagtgtacagtaacgttatcctcgacaaggtgtacgagccactcataaggtgggacaagagcggtactaaggtca cgggtgcgctcgcggagaagtgggagttcaagaaagagggggataacaaagttctgacgttccacctaaggaagggcgtt aagtggcacgacggcaaggaggtaaccgcagaggacgttaaattcaccatcgagctcttcaagagcaaccccgcaaagtt cgtgaacccggacacgctcatcatcaacggccttcaggaagtcaaggtagttgacaagtacacggttcagcttgtctaca accagtccgcagccgccgacaagttccttgagatggcctttacaacgctctacatagtcccgaagcacatatgggaggac aagaacataatctccgatccgacagcctctctcgacaagccagagcagctggtaggttgtggcccgttcaaggtcgctga gatcaagcccggcgagtacgtcaagctccaggcctttaaggactactacctcgggaagcctgaggtcgacaccgccatct tcaaggttctgaccgacaagaaccagttcgccatgatggtcgccaacggcgagctcgacgcgggctacttctacttcttt ggaaagtacctcaaagagttcgaaaacatggtttccggtgatccaaacgttaagatataccgcgcggcctcaaagtcaac ccaccttctggcgtttaacttcaagaagtggccctacaacgacctcaaattcagaaaggcaatagcctacgcactccccg ttgacaagatagtccagaagtactacggaactgacggagcaaaagcgggaagcatgggcttcctcggcccgttcttcggc gagtactgcaagtacatgcccaaggagaatctgtacccctacgatccggacaaggccaaggagatactcgatgagcttgg cttcaaggacgttaacggcgacggctacagagaaacacccgacggaaagcccttcaagatatacctcctcacgagggccc ccggagactcgttcttcagggacgcgataggcgatgaaatagcgaactacctcaaggacgtcggcatcaaggttgacgtt gacaaggccggcgactactgggacaagtggggagcaggctcgtgggacatggcgatagttggtttcgtcccgcacaagcc gacagacctcatctggttcaccagcgacaacccgggcaacagggtgggcttctccaacaagacctatgacgaaaccttcg aggagttccagaggaccggcgatccggccctggcccacaagctcgaggagatactcgccaacaacgtcgtcttcatagcc ctctaccacccgatagtcgcaacgccctacagggttgaccgctacaaggactgggcgccaaacccgaggttcttaacgct tggctactggtcgctccttggaaacccggagaagccaacgaccacaacttcatcagaaaaatcctccacaacgacgtcat cctcaaagaccccctcatcatcgacctcaaccaccaagaaaggtgagaaaggcctttgtggaccggcggcactggtgctc tttgctgtgcttccgctgttgaagaggagaagg TGAGTCCTTCTTTAATTTCTTTTTTGACGAACTTCTGGTGGTGAGC CATCATGGCAAGGGGAATGGTCTCGTACACGCTCGCTAAAATTGCCCACAGGCTTCTCACCCTCATCTTCGTCATCCTTA TCATATACACCCTCCTAAGACTTGCCCCGGGAACGCCCTTCGATCAGTACCTCTACCAGGGAAAAATAACGGAAGCCCAG TATGAGGCCCTCCTGAAGGAGTGGGGTTACAGGGACAGCTTCCTCGTGGGGGCAGCCAAGATGCTCTACGGCATGGCCAC GTTTTCGCTCTTCAAGATGAAATCGCCAGTTTACAATAAGCCCATAATCGATTTGATATCGGTTCGTCTACCATACACCC TCAGCCTCGTTACCGCCGCGTACTTTTTCGGTGCCATGCTCGGAATGATTTTGGGCCTGTACTGCGCCCGAAACAGGGGC ACGCTCAAGGAATCTGCCATCATCTGGATAACCCTTGGAATAAGATCCCTCCCC