

>tg0394 Zinc carboxypeptidase, M14 family, putative carboxypeptidase A

>tg0394 Zinc carboxypeptidase, M14 family, putative carboxypeptidase A

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 376205 - 378374 (Additional range around tg0394 is :500nt.)

>Thermococcus gammatolerans EJ3 TTTCGGCTGGAGGCTCTCAACTAAGGCCCCTATCCTCTCCACGAGGAAGTTTCTATACTCCTCGACGAGTTTTACTTCAT TCTCATCGAGCCCAACGCTGTTCCAGAACGAGGTAGAAACTTCCGGGCCGGAGTGGGTGTGTGTGGCCGAGACGAGGACG CTTTCCTTTGGCAGGTCGAGGATTTCGCTGACTTTCCTCGCTATCTCCCGATAAAGCTCGTTATCCACCCTGACAAGGTC GAGGGAAATTATAACAGCGGGTCTTTCCTCCTCGAGGTAGAGGGCCTTGGCATAGAGAGGGTCGAGTGTTCCCACGCTCC TTCCCTTTCTCAGGGCGTAACCGGCCATTGGCATCGGCTTTTCTGGCGTTATCTCGACCTTTCCCGAGGCTACGAGCATG GCGACCACCCGTTATAAAATTTCAGCTTGCTTTACAGTAATTTGCATATAAACCTTTATAAGATTTAAAATTTAAATCAA CACTGTAAAAACATCACGG gtgagagccatggtaaacccgcttttcagactcattccctacgaggaggtctcgcgagcg gtagaaacctcgggctgggagtacgaagtcgtcggaaagagtgcctccggaaggaacctctaccacgtgaagatgggaaa ggggaaggtgaggctcctcatagttgcgggaatacatggcaccgaaccagcgccggtgaacgcctcggttgtgctcttga acctcctcaaggagaggtaccccctcggctacaactttgagaggctgaaaaacgtcgaggttcacctaatccccctggca aaccccgacggctttcagctcaactacgagctcttcaagaagaaggacttcgaaccccactggagccacgtctgggaaga ggcgaggaggaacgccaacggcgttgacctgaacagggactggatgaggctgagccagccggagacgagggcaatacaca gggtaatcaacgaggttgacccacacctagtccttgacctccacgagttctacgcgagaggcggctgtcccccgaagtgg gccgacgaaacagaggggttcctctcaacgctcaccgacacgccctacaactgggtcaacgaggcaataaggctcgtctc ggagaaggtggccaaggagatagcgaggtctctcccttggaagccgaagatgaggcacttcatggccgaggcgcacgaat tcccgatagttccgaacaacgttctcggctcccacgtccccttcgagggctcggcaaaagttctcgtcgagagctggggc accggacttggaaactacctcctcccggatagggtgggcattcacctcaacgcgattctcactgccatagagttcatgga ggagaacccggaaaggttcatcgagatgaagaaggagtggaggagggaggaaaccaaggttggaagggagtacagggagt tccgcgtttctggaagggagctcgagagggcgaaggaagttctgtcactgcacggtatagagttcgaggagagagaggat gagctcatagtgaagatgccccagggtaggagcaggattgcgattctcctcctcgacagggagcactggtataaccaaga gctgaggaagaggtggaaggggccgcacaccctcgacaagttcttcgacgtcaatgtggaagccgtaagg TGAGAGCAT GATAAGAACCGCCGGGGAAGAGGACATACCCGGGATAGTGAAGCTCATGAACGAGTGCTTCAGGACGTACAGGAGCTGGG GTCTTAACGAGGAGAAGTTCCGCGAGTGGCTGAGGAGCGACCCGGGAGTTAGTCTCGATGGCACATACCTCCACATCGAA GGCGATAAGATAGCGGCTATGGTTCAGGTCGTTGAGAGGGAAATCAAAGTCGAGCGAGAATTTTTCAGAACTGCCGGAAT AGCGAACGTGTGCACGGGCCCTGAATTCAGGGGGAGGGGCCTCGCCAGGGAACTCTTAGAGCACGCCCTCGTGGATTCCC TTGAGAGGGGATACGAGCTCTCGGCGCTCTTAGCTGGATACGGGGAGATTGCCCACTCCCTCTACAGGAAGCTGGGGTTC AGGGATGTCTACTTCACCCGCTACGGTATAATGGTTCAAGACGAGCTGAAGAAACTGCCGGAGGCTGAAGGCGTTAGATA CGCAACGGAAG