

>tg0398 Succinyl-diaminopimelate desuccinylase (dapE)

>tg0398 Succinyl-diaminopimelate desuccinylase (dapE)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 383280 - 385515 (Additional range around tg0398 is :500nt.)

>Thermococcus gammatolerans EJ3 TCCCGACGGTTATAGTGGCGACGACGATAGCGCTGATAGTCGGGGCCTACACGAAGGTCAGGAACCTGCCCCTGCTGAGG CCAATAGGCATGTACTTCCTCTACCTGACGATATTCGTCTACATCGCCCAGAAGACGGACTTCGCGAAGCTCGCAGGTGC CGCCCACGTGGTGCTGATACTAATGGCAGTGTTCTTCATAATGCTGGCAATACACTTCATCGTCATCCTCCTGGGCGCGA AGCTCATAAAGGTCGACTGGGCAACAACGGCCATAGCGAGCGTCGCCAACATCGGGGGAGGTGTCACAGCCCCGCTCTGT GCAACGGCCTACGGCGTCGAGGAGCTCGTCCCTCTGGGCGTCATAATGGCCTCGATAGGTTACGCGATAGCGAACTACGT TGGCTACTACGTGGGTCTGCTCTTCCTAAAGCTCTGGGCTCCTGGGGCCCTCTCGGCCCTGGGCCTCTGAGTTTTTCTCT CTTTTTAACAGCTTTAGCGG gtgatgaaaatggaggagtaccttaactacgccctggagatgctttttgagctcgtgcg gattccaacggttaacccgccgggcgagaactacgagagggccgcgaagctcctcaaggataagcttgaggagatgggct ttgaggtcgagctgatagaagtccctgaggattacctcgacaggacttatccctactcaccgaggcacagggggaagccg aggttcatagtctacgggagcctcggaaagggaaaaacccttcacttcaacggtcactacgacgttgttccgccgggaga cggatggaggcacgaccccttcaccccaacggttgaaggggacaggatttacggcaggggaacgacggacatgaaggggg gcatagcaaccgccctcgccgccctcaagtatgcggtcgagcacgatatgataaactacagggtggaggtcgccttcgtt ccggacgaggaaagcggcggaatgggaacgagatacctgatggaggaagtcggaataaggcccgactacgttgtaatacc cgagccgaccagccacaggctgatagggatagggcacaagggctttgcgaggggcgtcgttaaggtcatcgggaagcagg ggcacgcgagcagaccctggaaggccgtaaacgcctttgagaaggcctgtgagctcgtcgttgacttcctgccgaggtac tgggaggttctgaggggcaggaaaactgagttccctgttgaggacgagaactcggcgcatccctcaatagccctcggggg ctacgcagagagcccaacgaaaaaggacaacataatcccaggagagttctacttcagctttgataggaggataatccccg aggagaacgctacggaagttgtggaggagctcgaaaggttcctgagggaatcggcatccaaagcaggggttggcgtggag gtcgacgttaagagcctcatagaggcctccgcgacgccccttgattcgcccatagtcaagctcgcccaaaaggccgtcaa aaacgccctcgggatagagccaacgctcatgctgaacgccggcaggtacgacctcgtttactacaggcgctttggcgttg aggggatagcctacgggccgggcgtaaggggccaggcccatgcaatcgacgagtacacgacggtcggggaaatcgaaagc gttttgaaggcctacatggagctcctcaggcttttcggaggcggtggcgatggggac TAAGCTCACGGAGGAGCAGGTT AAGAGGATGAAGGAGGACGCCCTTCTCTATCATAGGAACAACTTCCCCGGGAACGGAAAGATTGAGGTCATTCCCAAGGT GAGGCTCAAAGACTTCTACGACCTCAGCCTCGCCTACACCCCTGGAGTTGCCGAAGTCTGCAGGGCGATACTCAGGGGGG AGAGCGTCGACGATTACACTGTGATACCAAACACGGTCGCCGTGGTTACGGACGGCTCGGCGATTCTCGGCCTCGGCGAC ATAGGCGTCTTAGCTGGAATGCCCGTCATGGAGGGCAAGTGCGTCCTCTTCAAGGCCCTCGCAGGCGTTGACGCGTTTCC GGTTCTCATCAACACCAAGGACGTTGACGAGATAGTGAGGACTGTTAGACTAATCTCCAAAGGGTTCGGCGGGATAAACC TCGAGGACATAAGCGCCCCGAGGTGCTTTGAAATCGAGGAGCGCCTGAAGAGGGAACTCGACATTCCGGTATTTCAC