

>tg0409 Glycosyltransferase, family 1

>tg0409 Glycosyltransferase, family 1

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 396388 - 398524 (Additional range around tg0409 is :500nt.)

>Thermococcus gammatolerans EJ3 AAACTGAGCTCCTTCAAGGACGGCTGGCGGCACCTCAGACTGATGCTCCTATATTCCCCGACCCACCTTTTCCTGATCCC CGGGCTCCTGCTTCTCACCCTCGGTCTTTTCCTCCTGGCATACACCTACGTTTTCGAGCCTATAAGGCTCCACACCATGA TACTCGGCTCCCTTCTCCTTATCACGGGGACTCAGGTTCTCGGCTTCGGCGTCTCGGCCAAGGTTTACGCGGTTAAGGAA GGTCTTGAAAAACCGGATCGGATTACGGGCTTCTTTATGAGGTATTCCATCCTCGAGGAGGGCCTCTTGGTTGGGGGGAT TCTCCTGCTCATGGGTCTCGTCTTGGGTGTTAGGCTGTTCCTCCAGTGGAGGAATGCCAACTACGGTGCGCTGTTCCACA TTCAGGAGGCCATCCTGATACTGACCCTCATAACCCTCGGCCTTCAGGTGGTCTTCTTCTCCTTCTTCATCAGCGTGTAC ATGCTCAAGGAGGGTTAGCC ttgcggatcctcatagtttccccctatttcccccctgagggtggtgggcttgagagcta tgcaattgccatggtcgaagagctctcgaaagaacacgaggttcgggttatatgtatgagcaggtttggttcatcgaaag aaaccctgcgggttcagggaaaggccgtacctctcgagcgcgtgaagggctttgtcctctcgaatacacccctgagcctg aggttcactctgaggcttttttcaatcgtcaaaaactggaggcccgacctgataatagcccacacccccgttcccttcgc cgcggacgtcgccgccctcgcctccgctctcttcggcgttcccctcataatcgtataccacaccctcggattgaggaagg gggccctccttgatgtcattgcctcaatttactcgaagaccctcgagcggtttactctctctcgggcggcgcttttggtg gcggtttctccgtcggtcaggaattacctcagagaaacgggctttcgttccgttgttgtccctcctcgaccgaagctgga acttctcagcgcggctcagaagaaacttccccctaaggagaagatcgtccttttcatcggtcagctctcttccttccatc gcttcaagaactttgaactcctcctacgggccttcgctcaggcctcgagggaccatcctgactgggaactgtgggtcgtt ggaggtggggatgaactgccgaagtaccgcaccctcgcccgggagctcggtctgagcaaaagagtcaggtttttcggtcc ggtctccgatgcaaaaaagcttgccgagatctattccagggcctcaatcgtggttcttccttcatcctttgagtcctttg ggcttgtcgttattgagggagccatcttcggtgccatcccccttgtttcgggtgcagtggcgaagaatatctttcctcta tatcctggggttggcaaggcctcttacgtgttacggcaaaaggcggagctttcttcgatgttaagcgagctgtttgggca tccgaaaactttaaaaaagctttctgcaatgctgcgggagactgagggatccaggaaatccttcaaacggtttagataca tcagcgttcttttagaactcaatcttttggaaaaattt TGAAGATAGTGGGCGTTTTTTCGTGAAATTAGCTTCCGTGC CTTCAATTATTAAATAATGCTCGGTAATCCGGCGAAAGGTTTATATTTATCTGGTGGCCTATAAGGTATTGGCCTTCCAT GAGGCCGGCCTCAAAGAGTGGCAAAAAAGGAAGGTAGGTGAAGTAGTATGAATAAGCGCAGGAAAGCGCAAATTTTTAGC CTGATGCTGGCATTTTTAATGCTGGCATCAGTCATTCCAGGGACGTTCCTCAAACCAGTGAGCGCTGCTGGTTACATTAC TAGTGTTAGTGCCGAGACTAACTACGGAGATGGAGTTCTGTTTGCAGGATTCCCGTACTTCGTTAACGTAACAATTAACG CGAGCTCCAGTACTTTCGCAAACGTTACCCTCTACTACGAGTACCAGGATGGACACAACGTTACAGTGTACTCGAGAGTT GTTCCGATAACATCTCCCCCAGGATCAATAAACGTCCTCATAAACTCGAGCGACCCGA