

>tg0419 tRNA nucleotidyltransferase (CCA adding enzyme) (cca)

>tg0419 tRNA nucleotidyltransferase (CCA adding enzyme) (cca)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 412039 - 414400 (Additional range around tg0419 is :500nt.)

>Thermococcus gammatolerans EJ3 AAGAGAGGATAGGGAGCAAAGCTGCCAAGATAAAGTTCGTCGAGAGGGAGAACTTCCACGTCACGCTCAAGTTCCTCGGC GAGATTGACGAGGTAACGGCGGAAGAGGTTAAGAAGGCCCTAGCCGAGATAGCGAGAAAGCACAAAAAGCATCGCGTTCG CGTTAAGGGAATCGGCGTCTTCCCGAACCCGAACTACGTAAGGGTGATATGGGCCGGAATAGAGAACGACGAGGGAATAA AAGCGATAGCGAACGACGTCGAGCGCGAGATGCGTCGCTTAGGCTTCAAGAAGGACAAGGACTTCGTGGCCCACATAACA ATCGGACGCGTCAAGTTCGTCCGCGATAAGGTTGAACTGGCGATGGCGCTCAAAGATCTTGCCAACGAGGACTTCGGCGA GTTCGAGGTCGAGGCCATAGAGCTGAAGAAGAGCACGCTGACGCCAAAGGGTCCGATTTACGAGACGGTAGCGAAGTTCG AGCTCGCGGAGTGAGTGCA atggagatggaagaagtcctcagcgaagtcattcaaaggataaggccaagcgatgaagag agagccttcgtgaaaggcctgatggaggagctgagaacaatagccgaggagagaatagaggagctcggcctcgacgctag gccctacttcgtcggctcactcgcgaaggatacttatctggctggagaccacgacattgacctattcctggcctttcccc tcgaaactccccttgaggagctgaggaaaaaaggtctggaactcggaaaagccatagccgaaaaactcgactcccacgag atagcctacgcggaacacccctacgtccgggcgagatacaggggagtgcgcgttgacctcgtgccctgctacgacgtcgg aaactggagggatgtgagaactgccgttgaccgctcgatactccacacgaggtgggtgaatgagaacctcagggggcgga acgacgaagttagactgctcaagcgcttcctgaagggcatcaacgcctacgggagcgagatttacgttaggggcttttcc ggctatttggccgaaatcctcgtcataaagtacggttctttcctcgatgttgtcgagaaggcggacttcctactgaggca gaagataatagacccagagaactggctgagaaaagagcctgaggttgcgctcaagaccgtgaagagggaaaccgaggagg acagacctctgatagtgatagaccccgtcgacccgaggcggaacgtttcggccaacttgagctgggagaagtacgggcgc ttctacttcaagagcatagagttccttgagaatccctcggtcgggttcttcttcccaccggagaagcctaaggggagcta cctcgacgagctgaggaagaggggaacagcccttgtaacgctcctgatcaatgtccccgatatggtggacgatgtccttt taccccagctggagaggagcgcgaggggctttgagaggacccttgagagggaaggcttcggagtcctcggctgggacgtc gggagaaaaggcagagccttcataatgctcgaactcgacagggaaaggcgcgagagggtgaaaattaaacccggcccgga gtttttcaccgagcgggggcgggacttctacaggaaaaatgaaaaggtctggctaatagggaaaaggctctactcggaaa agctcgtccgggagagcgtcgtggatgttatcatcgaacttctcgaaaagaaccaggtatcgctcggaaaaggaataagg gacgcaatcaggagggcggatatcctgttaaactacgttcccaaggagctggaggaggaggcgtatctcttcctaagcag ggaaaaatggaacattaaaggt TAACGCCCGTGCTCGCAGTACTGGGGATTCTCCCAGAGACCGTGTTTCTCACCTGCA ATGTGACCGGTATCCGCAACGGCCCACTCGAGGTTGTAGCCCTCGATGATGCCCCTCAAGTCACCTCTAAGGTCACGTTT TCCTACGTAGAGCGCGGCCCTCGTCACGACGTTGTAGCCGCTAGTCGGGACCTCTGGCTTCAAGGCCTCGTGCCAGGCCT TCTCGCTTGTCTCCCATCCTTCCATTGAGGGCATTGCGGAGAGTTTCCAGAGGTGGTAGAGGTTCTCGAAGTTGAGGAGC TTTAGATAGGCTCCGAGGAAGAGACTCCAAAGCTCGCTTCCCTCGAAATACTTCATCAGCTCAATCAGAGCCTTCGCCAT TACTGAGACGTTGGAGAAGGCAACGCGAGTGTCGAGGTTCTCCCAGAAACGCGGGCAGGAGTGGTTGGCGAGGAGCATAA GGTAGTAAATCCTTCCGAGCTTCAGAGCATTTCTGTCTCCACC