

>tg0433 Voltage-gated ClC-type chloride channel

>tg0433 Voltage-gated ClC-type chloride channel

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 426889 - 429610 (Additional range around tg0433 is :500nt.)

>Thermococcus gammatolerans EJ3 CATGGACTTTACTTTGAACTCGGGCATCTCCCCTTTGAGCTTCTCGTAGTCTTCCTTCGTTATCTCTCTCGCCTCACCGT CCTCGACGAGGTAAAAGATGCCGTAGTCAGGGTCACGGTAGGCAACGAGGAACTTCTCCACCTCGATGTCGTCGAAGTTC ACGAAGATGACGTTTCCACCTGTGTAGGGCCTCCTGCACTTGAAGGGAAAGCTGGAGGAGTTGAGCATGGCATCGCCCAG GGCCTGGTTGGCCCTCTCCCCGTTTATCTCGGTCCAGAAGGGTCTTCCCTCGAAGTCGCCCTCAACGACGATGAGGAACC TCTGGCCGTCGAGCTCGACTATCGGGGCGCCCTTCTCCTGAAGTATCTTGAAGAGCTCGCCGATTGTCTCGGCGTTTCTG AGCGAAGCAACAAATCCTTCAACCTTCATAGTTTTCACCGTTAGAGGTTCTGGAATGGGGTATAAAAGCTTAAGCTTTTT ATTTGAGACGCTAAATTCAT ttgatgacctctggaaacggagcgtacctcagaaaatggggcattgtaatggccttttc catactggcgggcgtagttggcggtctgggggccgttgtgttcaggcttatgatacgcttcactcataagtttttcttcg gaatgctcctcccgcgcctctcttttaccctctatcatctgaatctcggctacgttcttctgccagcaatcggtgggctc ttcgtggccctgcttgtggttcgctttcccgatatcaaggggaacggaatccctgaggtcatcgaggcggtaatcttcaa aggtggaagaatcggcggtgtctttgcgatagcgaagatagtggcgacttcagtaaccataggctcgggcggtagcgtcg gcagggaaggcccaatcggcttcataggggccgctttgacctcggccttcgcgaagtggtttggcctttccagggagatg cgcaagctcctcgtaacctgcggtcttgccgctggaatcgcgggaaccttcaacacgcccctcgcgggggccatgtttgc cctcgaggtcgtttacatgggtgctttctcaataaacctcgttcctatattcatagcctccgtgacggggaacgccgtta cactcgccgtcctcaggagggcctttgaggttgagattccaggaggaatggggcacactctaccagagcttccgtttttc ttcgttctggggttgctcctcggcgccctggcggccctctacgttcgcgttatctatgccttcatcgagggtttcgagcg ccttccagtccccgaagtctttaaacctgttcttggcggtctgggcgtgggtctcctcggcgctttcttcccgaactacg gcatctttggcgttggttacgagggcatgagcttggccttctacgggaagctggtagtgtggctgctcctaaccctgggc gtcttgaagatgctggccacggccctgaccataggctcaggccagagcggtggtgtcttcgcgccgagcctatacatagg caccatgttcggttccgccttcggaatggtcgtcgccaagctgtttccatctttgggggccatgccgacggtgtacgcgc tggctgggatggcggcgttcttcagcggaatgacgcaggcgccgataacccagattttaatggtaacagagcttacaagg agctacgcgattcttccagctgttatgacctcggcaacgatgggttttctcaccgcgaggttcttcctgaagggcgagtc cgtgtacacactaaagctcgtcaggaagggctaccgcgttaggacggggaaaccagtgatcttagagacgatatccgtcg gggagataatgacgagggagccagtctacgttacggcggatatgacgctcttcgacgtggagcacctcataagcgagact ggccacgactgcttccccgttgtggacaacgagggcagggtcatcggaataattggggtcaaggacatactgaagaagcc atcgtcgctgaagagaatgagggtgaggcgattcctccgcagggcgtacggtgttacgtatccaactgaaaccgccgaga cggcgcttgaaaagctgatggcctacgaccagaacctcctccccgtcgtcaggggaccgaacgacagaaggctcatcggc gtcgtgaccaaaaaggacatatacaccgcatactaccgcggactggaggggatgtacatagac TGAGGTGGTTTCATGC TCGTTGACGCTGACCTACACATCCACTCGCGTTACTCGAAGGCCGTCTCAAAGGCAATGACGATACCAAATCTGGCAGAA AACGCGCGCTTCAAAGGTCTCGGCCTGGTCGGGACGGGCGACATACTCAGCCCCCACTGGGAGGCCGAGCTTCTCAAATA CGCGAAAAAAGTTGACGAAGGGACCTACGAACTCAATGGAGTCCGCTTCCTCCTCACAACTGAGGTCGAGGACAGCAGGA GGGTTCACCACGTCCTGATTTTCCCGAGCATAGAAACCGTCCGTGAGATGAGAGAACGATTGAGGCCGTATTCAAACGAC ATCGATACCGAGGGAAGGCCGCACATTAACCTCTCAGCTGGGGAGATAGCCGACATGGCCAACGAGCTCGGTGTCTTAAT CGGCCCCGCTCACGCCTTCACCCCCTGGACGAGCCTATACAAGGAGTACGACAGTCTGGAGGAGGCATATGGAGGAGCTA AAA