

>tg0440 Glycosyltransferase, family 1

>tg0440 Glycosyltransferase, family 1

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 432880 - 434998 (Additional range around tg0440 is :500nt.)

>Thermococcus gammatolerans EJ3 TCTGAAGCCCTCGCCTTAATTCCCCTCGTGATAGGGCTCGCCCTCGTATGGTTCAAGTGGGAGAAGTTCATAGAGCTCAC CCTTCGCCTCTTCAGGGTGAACCTCTCGGAGGAGGAGCGGGAGAGAATAGTTGCCCTCAGGAAATGTGGTGACGTCAACC TAATTGGGATAGGCACCAGCTCCCTGGTCTGGGTTCTCGACGTTCTCAGGCTCAAGTTAATTACATTGGCAATAGGCTTG AACGTCTCCTTTCCAGTTTTAATCCTCGTCTCGATTATTAACCTGATGCTCGGTATCGCGGCCTTCACTCCTGGAGGGGT TGGAGTGGTTGAAAGTGGCTTGATCGGGGCACTCACATACCTGGGCTTTCCCCCAGCGTTGGCTGTTTCAACCGTGCTGC TCGAAAGGTTTATCTCCTATGTTCTTGGTAGCATATCGGGGTTGCTGGTGCTCTTCACGTCCGGGGGAAGGGAAGTATGG AGAGCCTTAAAATCGCGCTA gtgagcgactggtactacccaaaactcggtggcgtcgcggttcatatgcacgaccttgc gctttacctgaggaagctcggtcacgaagttgatataatcacgaacgaccgtgagactggaaaggaaaccgagctgaaaa gggaggggataggtctaatcaaggtccccggttacacctttgggagcattggaatcaatatgacggtcttctccagaaac gcctctcgtctcattccatacgtgcggaactacgatgtcgttcacggtcagcacgctttcactcccctcgccctcaaggc cgtctccgccggtaggaaggccggcaaagccactctcctgacaacgcacagcatcaactatgagaactcaccggtgataa aggcccttgctaggatggcctttccgtacttccgctattacttgggcaacccccacaggataatcgccgtcagcagggcc tcaaaggagttcatgaggcgctttacccgcatccctatcgaggtaatccagaacggtgtcaacgtggatttctttgacgt ccccctttcaaaggaggaagccaaggagaagctgggccttggcgagagggtcatcctttacgtgggcaggctggagccga gaaaaggaattagcacgctcatcaacgcgatgaaacacgtggatggaaccctcctgatagcaggccagggaagcatgctt ccccttctcagggagagggcaaagctcctcggcgtatccaagaaagtaaagtttctcggggtggtcgagtactcgaggct tcccctctactaccgggcaagcgacgtcttcgtcctcccgagcctgagcgaggcctttggcatagtcctcctcgaggcaa tggccagcgggacacctgtcatcggaacgaaggtaggtggaatccccgagataatcgacggctgtgggttgctcgttccg cccggaaacgcgaaggagctcgccaatgccataaacctggttctcaacaatcagagcgttgagaggcgccttagcaggct tgggaagaggcgggtcgagaaagtctacgactggaatgtagtggtcaggaaaattgaggctctctaccgtgaggttctcg acgaggtggtaggggatgga TAAAATCGTTATTCTAACCTTCGATGTTGAGGAGGATTGCCCTCCGTTTGCGGAAACCC GAAGGGGCATGGAGGAAGGCTTGCCGAGGGTTATGGACCTCCTCGAGGAGTTTAAAATCAAAGGAACGTTCCTCTTCACC GGCAGAATCGCGGAGGAATTCCCGGAGCTGGCTGAGCGCGCTGGGAAGAAGCACGAGCTCGGCTGTCACGGTCTTGAGCA CGAGCGATTTGACCGGCTTTCCTTTGAGGAAGCAAAGCGCAGACTTGAAGAGGCGAGGGAAATTCTTTCCCGCTTCTCCG ACCCCGTCTCCTTCCGCGCCCCCAACTTTCAGTTTCCAGATATGTACTACCGCATTCTTGCCGAGCTCGGCTTTAAAGTC GATTCGACGAAGGCCAGGCACAAGGGCTGGGGAGAAGGAGTTACCGAAATCAACGGCGTTCTTGAAGTTCCCGCCACGAC TACCTCTATAGTTACGCGCCTTCCCTGGAAGATACAGAAG