

>tg0442 Radical SAM family protein, lectins/glucanases related

>tg0442 Radical SAM family protein, lectins/glucanases related

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 434732 - 436787 (Additional range around tg0442 is :500nt.)

>Thermococcus gammatolerans EJ3 GGCTTTCCTTTGAGGAAGCAAAGCGCAGACTTGAAGAGGCGAGGGAAATTCTTTCCCGCTTCTCCGACCCCGTCTCCTTC CGCGCCCCCAACTTTCAGTTTCCAGATATGTACTACCGCATTCTTGCCGAGCTCGGCTTTAAAGTCGATTCGACGAAGGC CAGGCACAAGGGCTGGGGAGAAGGAGTTACCGAAATCAACGGCGTTCTTGAAGTTCCCGCCACGACTACCTCTATAGTTA CGCGCCTTCCCTGGAAGATACAGAAGAGGTTTCACCGGAAGTTTGAAAGTCCAATCGTTTACATCTTTCACCCCTGGGAG TTCGTTAGAATGCCCAGGACCCTTAGACCCGATTGCTGGTTTGGGACTGGAGAAAGTGCCCTGGAAAAGCTCAGGAAGTT GATTGAGTTCCATCTCGATAACGGCGCGAGATTTTTAACGCTTCGGGAGTTCTACGAGGAATACCAAAAGCTTAAACGTG AGTGAACGGACTCTAATTGG gtgagagttatgagggaggccctttactgggagcccctcgaggggggcaaagttaggtg taagctctgtcctctcaactgcatcatcagcgagggaaagaggggttcctgcagaatcagaaagaacattgggggtaagc tctacacgctcaactacggcaaggtctcggccatcggagccgacccggtggagaagaaaccgctcttccacttctggccc ggctcgtgcgcgctctcgataagcaccgttggatgcaacatgcactgcaagcactgccagaactgggagataagtcaggc ggatgaaaccttcccctacctccacgatatgacgcccgagatggtcgtggagataacgaagcgctacggctgtgagagca tagcctacacctacaacgagcccgtaatctggtacgagttcgtcctcgacacggcgaagctcgcgaagaaggaaggcatt tacaacctcctcatcacaaacggctacatcaacgaggagcccttcagggagctcgcgccctacatcgacgcgatgaacat cgacatcaaggccttcagcgacgagttctacatgaagatagcgagcgtcccgagtggtgagccgagcaggaggacggcgg ttatagcgaagaaggactttggaatccacgttgagctgacgtacctcataatcccgacgctcaacgacaaggaagaagag atacgggccttcgcccgctgggtggttaatgagctcggcgacgacacgcccgtccacttctcgcgcttcttccctcacta caagctcctccaccttccgccgacacctcttgaaacgatggacatggcctaccgcgtcgccaaggaagagggtttaaagt tcgtttacatcggcaacgttccagggcaccctggggagaacacctactgcccgcgctgtggaaggcccttaatagtccgt tacggctttgagattaccgagtacaacataactgaggacggaaggtgtaagtactgcggtgagaaaatcccgatagtcgg cacctacaagaaaaagcactatcctgggatgtggtgg TGAGGGTGATCGAAGCTATACTCTACTTTGAGGCCCTTGGGA GAACGAGGCTTGCGGTTGAGGACAGGGTGAGAAAAACCTCCCGTGGACTAGAGGGGTCCAGGTTGGATGTAAAGCGGCTC GAGGTGGGGGAGGTCATTGAGGAGCCGGAACTCGATCCCCTTCGCTTTTCGGCCCTCCTCGAGGCGAGGGTTGAGGGGGG CCTGGAAGATTTGGTCGAAGTTGTTGCTCGATATGGCCCAACCCTCGTTGAGATCCTCAGACCGGGCAGGCTTGAACTCC GTGCCGAGGACCTCTCCAGGCTTTTGCTCGGGCTCTCGAGAACGATTAGTGATCTGGTTGAGGGGGATATCCAGGTACCG GTTCCGCTGAGCCTGAAGGAGATTCCGGTTCCTCAGGTAGGATTTGACGAGGAGGAGCTCTGGGAAATGATCTACCAGGA CAGGGGTATTCTATACGGGCTTTCCCTTCGTCTGCCCGAGGAAATCGCGGAGGATAC