

>tg0447 hypothetical protein TGAM_0447

>tg0447 hypothetical protein TGAM_0447

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 439899 - 442599 (Additional range around tg0447 is :500nt.)

>Thermococcus gammatolerans EJ3 GCCGTTCTCGGACCCGTTGATCCACAGCTCGGCCAGTACCCAGCTCCGAGCATTGTGAAAGCAGTGGAGCAGAAGGGAGC CGAGAAGGTAGACGACCAGACACTGATCCTTGCTGATGTGGCCAAGAAGGCAATAAAGCAGGTACAGGACTTCGTGTTCT ATCTGCTAAAGGACAGATACGGCGAGGAGAAAGCCAGGCAGCTGGCCCAGACACTCACCGAGGGCAGATGGACCCATGAT TATCCAATTACTGTCGACCACGCTAAGGAGATGGGACTTCACGTTGAAACGGACGTTCCAGAGGAAGTCTACGCGCTGAT GGAGCTCTACAAGCAACCGGTAAGGCAGAGGGGAACCGTCGAGTTCATGCCATACCCGGTGAAGCAGGAAGGGGCCAAGT GATTTTTCATTTTTAGTTACCGAAATTTTTAAAAACTTTATGTTTCTAAAAACTTCAGAGCCTCTCAAGAGGCCAAGTGA AGAAAGGAGGTAGGATACC atgtacctgaagagaaggcaccttgagatactcagggaaatgaagaagaccgatagtcag accgagattgaggccaaactgccggaggagtttcagataagggcaatcgagctctacatactcggttttgccgagcttga gggcggaaagattaagctcaccgaggccggaaggaagctccttgagattactgagttgctcaacctcgacgagcttcccg aggtcgtagcggacaccgagataatgaagatgcttgagctcctcgaggagaccggaaaggtacccgagggctggctcgag aagctgaaggagaggaagctcgccgatgagaacggcctcaccgagttcgggaaggccctcctcaagctctaccgcgagac ccacccggtcgtttacctgaccccagagatagtgtcgttcctcaggggaatgccgaaaataggaaccctcgatgagctca taacctacaagaactccaagctctacggcgacaacatcgtgaacgccctccaggcgatgcgcctgctcctgatctccccg ccgaccgagaatggaagggccttcgcaacgactccagcggcgaagcttgccctcaaagctgtcagtatgattccagtctt cgcgagagcgatagtcctcaggaaggaggacttcgaggccctgaaggccggtaggagcaacgccgagctggagagcatgg ggctcgccgacgagaagggaaccaccgagttcggaaaggccgtgatggagacctacgaggcgatgggcagggttgaggag aaggtcctcccgatttacctgctcaacgatgagcttgcagtcctcaaggtcatcaaggagattgaggagaagtacgagac caacccagacatactccccaccgagaaggagataggcaagcgcgttgaggtcgaggaccttggggccatactgcacctcc tcgagagcaaagagctggtcgagaggaggctcgtcaagaacagggacacctactggctcaccgaatggggtaaagaagct ataaacttcggaaccgtcagcccggacgcaatgaaggccgtaacctacgccgagagcggtgatgtgcccatagccgagtg ggtaatcaaggctcaggaggagggcgttgtcaaggccggcgtcaccgacaagggcaggttctacctcaagctcagccgct cgattaagcggaagccgttcctcaccagatacgacgcggcgatactggccaagaccccaaggaagaagtacatacacagg gacgagctggtcgagcttgtcagggactacgtcggcggagatgagaaggaaatcatcagggcaatcggcgaggcggaagc gaagggcttcgtcgttgagctccagaacggcatggtcaagctgaccgagctcggggataaagttaagaccgccctcgaga acgccaagctccaggagatagtcaaggtcaagttcagtgtcacgccaaccctctacaacgtgctcagggtaatctacgag gagcttgagaccttcaacaggatatggaaggagaagggcgaaatcaggggctacaagatggaggaagtggacgtcatcag gaagcacctcagcctcagcgacgacgagataaagaaagctttgacgatgctccgccagctcggcttcctcggaagcaaga gcctgaccgaagctggaaaggtcctcgttgaggcctacctt TGAATTTTTCTTCTTGAATGTTCCACTTTGATCGTAAA GCTTTAAAAAGCAATGGCTCCCATTTATAAAGGGGTTTTTAAACCCACCTGCTGGAGGTGCTGGCCTTGGTCGATATAAG TAACGTAAAGCTCAGAATTGAAAACATAGTCGCTTCTGTTGATCTCTTCGCGGAACTGAATCTTGAAAAAGTCATTGAAA TATGCCCCAACTCGAAGTACAATCCAGAGGAGTTCCCCGGAATCATCTGCCGCTTCGACGAGCCAAAGGTTGCCCTGCTG ATATTCAGCTCGGGAAAACTCGTCGTTACCGGCGCCAAGAGTGTTGAAGACATCGAGAGGGCCGTCAAAAAGCTCACCGA AATGCTGAAGACGAAGGTCGGAACGAAGTTCACGAAGCCACCCCAGATTGACATACAGAACATGGTCTTCAGCGGTGATA TCGGCATGGAGTTTAACCTCGATGCCGTTGCTTTGAGCCTTCCAAACTGTGAGTACGAGCCG