

>tg0452 McrBC 5-methylcytosine restriction system component

>tg0452 McrBC 5-methylcytosine restriction system component

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 443713 - 446086 (Additional range around tg0452 is :500nt.)

>Thermococcus gammatolerans EJ3 AGAAGCTAAAGACAGAGGATAGAAAAAGGCTAAACGAAAAACTAAACGAGCTATTTAGTAAACTGGGTAATGATAACTAC TTTCTCAAAACTCTTCTCGAGAAGATTAACGTTCGCATTACTGTCGTTAAAGACCGCGACCACAGGATAGGCCACAGCTA CTTCCTAAATGTAGAAACTGTTGAAGACCTCCACCACGTCTGGTACTATGAAGTGCTCCCTCTTCTCATGGAGTACTTCT ACAACGACTGGGAGACAATAAAGTGGGTGCTGAACGAGAAAGGCAAAGAGCATGGAAACGTGTTCTTCGAGAAGTTAAGG CTTACTGGACCAAACGGAGAAGAAGCATATCAATTAAAAGTTCTCGAAGGAGACGCCTTTATTGGGGCTTTAAAGAGAAT AATCAGTAAGAACACTCCATCTCAAGAGGGAGGAGCAACAACTAACGAGGAAAACTCCCCAGAGAACACCCAGTCCCAAA CTGAAGGGGACTGATTCGC atgccaagactaacgacaataacactctacgaacatgatgaaaagaggtacagggatatt gcaggagacaaaaaggctattcaagacgctctcatcaagttgaacaagcaatttaagaaggattttaaaaagctggacag atcagaagataattcagatactgaggatacaatagacgagagcaaaggcgtagtagaggtctatgccaacaagattaaag cacgacactacgtcggcttcgccgccgttgacaacgttttccttcaaattcttccaaaggtcttcaagccaaagaaagag caaacacaagagacacaggaagatacttgggagcccattctggcttttatacgaatgcttgacatggcctatggactaaa aatcaaagaccacgacttagcttatcttcaaggaagaaacctccggccgaacctttacgaagtttttatttatttgttcg ctaaaagcctctggagtgaggttcaaaggggataccatcgggaatacgttgaagttcacagggaagagaagtttcttcgg ggaaaactactgatgagcagacagatacgaaagcttccccaccagctaaacacctttagcgttgaagtccatgagctcat tgaggataatctgctcaacaggattttctatgcatcggttagagaagcactcagaagaacaacatggggcctaaacagaa agctcctcggtgagctgatgctggcctttgacggtattacgcctatacaccttaggacagagcactttgaacgcgttcat tttacaaggctcaatgagaggtttaggaggccctttgagctggctaaacttttgtttatgcctgcaagcggaaaaggaag gagtcgggaagttagcgggttctttgttgacatgaacaagctgtttgagaggtttattgagagagttctcgtgagaaacc ttccgccggaatacaaattgttctaccaagaatcttatccatttttaaaaaatcagaatggaagctcccaaaagcctgat tacgttgttagaaaaggtaacactcctgttgtagttcttgatgcaaaatacagagagctcaaagagagaatccccagctc ggatatgttacgccagctttatgtctattcacggatttggggttataagaccagtcacgaaaatgactcaaaacctcctg ccgtcattgtaattccttccagctcaacttacaatcaagggcttccagacaaaccgttagagtttgaatttttcgatgag aggaagctctttatagttgcgtacaacatggattatgtaaaaacgggtgcaatatttaaggcagataaaaactttagaag gagcctaaacaacattattggcaaactaaacacc TAAGTTATCTCAATGCTAAACTATAGCGCGGTGATACAATGGGCG AGATAGTTGTGAAAGTTCCCTCTGGAATGGAGCGCCTCATTGAACGGAAGATAAAGATTATACTTGAGCGGGAGATAAGG AAAGGGCTGAGCAGAGCTGTTCTTTCCAAGTACCTTGGCAAATTCAAAGGGGATGTCAATGAAGAGGACTGGTACCTCCA GTGAGCTTATCTTTTTGGACTCCTCCGTTTTAATCGAAAGGACTAAAAGGTAATCCCTCCGCCGTTTCGCTTTTTGAGGA GCTCCTCAACTCCAATTTGGTCCCAGTAATCAACGACATAGTTTTCAGTGAGTTCCTTTTTCACTACATTGCCCTCAAAA CTGGAGTTTCCCCGTTTACAATCAAAAAGCGGGGTGAAATAGGAAAAGTAATCCTCACCGAGGAACCAAAGGACTTCCTC AACCAGTTTCATGTTCTCCCTACGGACGATGAGGTTCTTGAGGTATCTTATGGGC