

>tg0464 pre-mRNA splicing, snoRNA binding protein, NOP5/NOP56 related

>tg0464 pre-mRNA splicing, snoRNA binding protein, NOP5/NOP56 related

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 453154 - 455419 (Additional range around tg0464 is :500nt.)

>Thermococcus gammatolerans EJ3 GGCCAGCTCAGATTGACGTCGGCGTTAGTGAGCTCCTTGATTTTAGCCCCAAGAACCCTATTGACATCGATGCTCGAAAA GTCATGCTTTCCCCGTCTCTTGGTCTTCACGGCGTAGGTTTCGTTTTCATCGATAAAGTCAGCCAGTTTTTCCGCACTCT CCGCTATCTTCTCAAGACTTGCTTCAGTCTCGACGATCACCGGAATAACGCGCTCCACTTCAGGGATCTGGAGTATCTTC TCAAGAGCATCCTCATCCGAGCTTTCCACAAGTACAAGGCCAGAATATCCCATCGGCGATGCCCAAACCTCCGCTTTAGG CAGCAGCTCGGAGATGTAGTTGGCCGCAACGCTTTCCATGCCCCTCTGCGTTTTGACTATGAACTTCCTACCGGCACCCA TCCCTAACACCAACCATCACTCAATCACTGGGTTTATAGACCTTTGGAGGCATGAAATCTTTTTATAGAGGGAGCCCAAT ATGATCCGGAGGTGGTAGT gtgagggtttacattgccgagaatgtcaggggcgtttacgccttcgacgagagcgggaag ctcatcgcgagcaaacccttcagcggaaagccagagacaagcctcgacaggcttttgaagggagaaccgagcgacgagct gagtgccctcctcgacgagctgaaaggagaggggtacgaagagttcatcgtggaggacaccgagctgagcagaaagctca aggagctcggctacaacgcaacagctgagttcccgaaccttgcgggagaaaagttgcgctcaagtccagaggagttcctc ggcgagaactggtttgacgagtactacaccgttggcgttgcattaacgaggctccgcatacaggagcagagcggtgcgcg cgacaagatgattatacaggccatcgaggcgctcgatgacatcgacaaggtcattaacctgctcgtttcgaggctgaggg agtggtacggcctccacttccccgaactggacgaaatcctgcccaagcacccgcagtatgtgactttcgttaaggaaatt ggcccgagggagaacgtgagcagggagaagcttgaaaagctcggcttctccgagggcaagattaagaagatcctcaaagc ggccgagaagtcgatgggagcaccgctcggtaagttcgacagcgaaatcataaggaagctcgccagcgagataagtgacc tctacaagctgagggagcagattgaggactaccttgagacggcgatggacgaggtggctccaaacctgaaggctctggtc ggtgcgaagcttgccgctcgcttgatgagcctcgctggaggccttaaggagctcgccatgatgcccgcttcaacgataca ggttcttggagccgagaaggccctcttcaggcacctaaggacgggcgccaagccgccaaagcacggcgtcatcttccagt accctgcaataaaccgctcgccctggtggcagaggggtaagattgcgagggctttagctggaaagctggccatagcggct cgcgttgactacttctctggtgaatacatcggtgaggagctgaagaaggagctcgagcagagaatcaaggaaatcaagga gaagtacccgaacccgcccaagaggaaggccaagccggagaagaagaaaaagaagaagttcaagggcaaggaaaagaagg gcaagaagcacgaaaagggcaggaaggagaagaagggtaaaggcaagcccgataagaagggtaagaagaaaaagaagggc aagagg TGAGGTAGATGAAGGTTAAGAAGCACAGGTTCCCGGGCGTTTACATCGTCATCGATGACGACGGGAGCGAGAA GATTGCAACCAAGAACCTCGTTCCCGGCCAGAGGGTTTATGGGGAGAGAGTTATCAAGTTCGAGGGCGAGGAGTACAGGA TTTGGAATCCAAGCAGATCAAAGCTTGGAGCGGCGATACTCAACGGCCTCAAGAACTTCCCGATTAAGCCCGGCTCAACG GTGCTCTACCTTGGAATAGCGAGCGGAACCACCGCTTCCCACGTCAGCGACATCGTCGGCTGGGAGGGCAAGATATTCGG CGTCGAGTTCTCGCCGAGGGTTCTCAGGGAGCTCGTTCCAATAGTCGAGGAGAGGAGGAACATCGTCCCGATACTCGGCG ACGCTACCAAGCCCGAAGGTTACCGCGCACTCGTTCCGAAGGTTGACGTCATCTTCGAGGACGTCGCCCAGCCGACTCAG GCGAAAATCCTCATAGACAACGCCAAG