

>tg0468 ATP-dependent protease, archaeal Lon-like protein

>tg0468 ATP-dependent protease, archaeal Lon-like protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 457184 - 460094 (Additional range around tg0468 is :500nt.)

>Thermococcus gammatolerans EJ3 GGGAAAGGGGAACACTACGCGAACCTCTTTTAGCAGGCCGTCCGGATAATCAACGGGAACGAACCTTGACAGGGTAAGCC TGACCAGCAACGCCCTCGCGGCATCGACGAGGAGTTTTTTGAGCTTCTTGTCCTCCTCAAAGACAAGTGCCCCGAGTTTT CTGGAGATACCAGGAGACTTAAGGGAAACGATTACCTTCGTTAGATCACCGTCAATTCCCTCGGCCAGGCTCATTATCCC CGCAACGTTCATGACATCGGTTAGGTATTCGGGAATCTTGGAGTTAACGGTGTTGCCAACCCTCGCAAGGAAACGAGCTA TCTTTTCATCTTCAACATCGATCAACTTGTCGGCGACCTTCCAGTTTCCGTGCTTGGCCGTGAACATAACGTGATCTTCT ACACTCCTCGGCATCTTCCATCCCCAATGCTAATAGCTTAAGAGGGGTATTTTATCTTTGCCCTTCTAAAGATAAAGTTA TAAGCCTCGTGGGGTAGCA ttgccagaggcagagaaggggatgctcatgggagaggagagaaccctccaaaccggcgag actctcgaccttgggattgaatttgaaacgactgaggagattaaagtccccgaaagactcatagaccaggtcatcggtca ggaacacgccgtcgaggtcatcaagaccgctgccggccagagaaggcacgtcctactaataggcgagcccggaaccggaa aatcaatgctcggccaggcaatggccgaactgctacctaccgagaaccttgaggatatactagtctttccaaaccccgaa gacgagaacatgcccaagatcaagacggttccggcatgtcagggaagaaggatagtgcagaagtaccgggaaaaggccaa gaatcaggagaacataaaatcctacctcctgctcgcgatagtcttcatggtcatgatggccgtcatgatgcagtacagca ctcagaacttcctcatggggctcttcgtaataatcctcacgataatggtcctttcaaacatgaggctgaaaacgagcgtt ctcgtgcccaagctcctcgtcgacaactgcggaaggactaaagcgccgttcgtggacgcaacgggggcacacgcgggagc actgctcggtgatgtgagacatgacccgttccagtccggtggcctcggcactcccgcccacgagcgcgttgagccaggga tgatacaccgcgcccacaagggtgtcctgttcatagacgagatagcaaccctctccctcaaaatgcagcagagcctcctc accgcgatgcaggagaagaagttcccgatcaccggccagagcgagctctcgagcggtgcgatggtcaggacggagccggt tccctgtgacttcatactcgtcgccgctggaaacctcgacaccgttgacaagatgcacccggctcttcgctcgaggatta ggggctacggttacgaggtttatatgaggacgacgatgccagacaccatagagaaccgcagaaagctcgtccagttcgtc gcccaggaggtaaagcgcgacggcaagattccacacttcacgagggaagccgttgaggaaatcgtaagggaggcccagaa gagggcgggcaggaagggccacttgaccctacgcctccgtgatctcggtggtatcgtgagggcagccggagacatagcgg tgaagaagggcaagaagtacgtggagagggaggacgtccttgaggccatgaagatggcaaagcccctcgaaaagcagctc gccgactggtacatagagaacaagaaggagtatcaggtcataaagacggaaggcggcgagataggcagggtgaacggcct agctgttataggggaacagagcggcatagtcctccccattgaagctgtcgttgcacctgccgcaagcaaggaggaaggga agataatcgtcacgggaaagctcggcgagatagcgaaggaggcaattcagaacgtctcagccataatcaagcgctataag ggcgaggacataagccgctacgacattcacgtccagttcctccagacctacgagggtgttgagggtgattcggcgagcat aagcgtcgccacagccgttatctcggcccttgaggacattccgatacggcaggacgtggcgatgactggctcgctcagcg ttcggggcgaggtcctgcccatcggcggcgctacacccaagattgaggcggccattgaggcgggtataaagacggtcata attcccaaggccaacgagaaggacgttttcctgagccctgacaaggccaagaagataaggataatcccagttgagacaat cgacgaagtactggagatagcgctcgaagactctgagaaaaagagagaacttttgagcaggataagaagtgccctgcccc tccataaatcc TGAGCGTTTCTTTTTATTGGGGCCGTGAGCATTTACATTTTAATGAGTAATATCACCATAAAATATCA TTGCATTAAAATAATAACACGGTAATTTCATAACATCATGTGATATTCAATCCCCCAATTAGCGGGATAAATGGCCATAA AATGTACCATTAAGAACTACAACCCATAGCCCCATCACAAAATGTTGAAAATTTTCCGAAAATCTTATAACCTCTAAGGG AATAGGGAAACTGTACACACCGGAGGTGTTAGGATGCCAAGGAAAGTTAAAATAGACTCCATCGATCTTAGGATCGTTCA TCTCCTCTCAGAAAACGCAAGAATGACGTACAAAGAGCTTGCGGAGGCAATAGGAACAACGCGACAAAGGATCTCCAGGA GGATGGACAAACTCGAGAGAATGGGGATAATACAGAAGTACACCATTCTACCGGACTACGAGAGCTTGGGATACTCGTAT ATAATCCTTGGAATAACACTAAAACCTGGTGC