

>tg0488 LSU ribosomal protein L10E (rpl10E)

>tg0488 LSU ribosomal protein L10E (rpl10E)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 473187 - 475206 (Additional range around tg0488 is :500nt.)

>Thermococcus gammatolerans EJ3 CCTCACGGTCGTGGGAAGGAGCCCAAAATCGCGGTCATCGCTGATGGTGCCGTTGCCGAGGCGGCTAAAAGGCTCGGGCT TGATGTGATTAGTGGTGAACAGCTTGAGGAACTCGCGAAGAGCCCGAGGGAAGCGAGAAAGCTGGCGAAGCGCTATGACT TCTTCATTGCCGCGGCTCCGCTGATGCCCAAGATAGGTAGGTACCTCGGTAGGTACCTTGGTCCGAGGAACAAGATGCCA CAGGTCGTTCCGCCGACCCTGACCAACCTCGAGCCCATAGTCAACAGGCTCAAGAAGACCGTCAGGATACAGCTCAAGAA CAATCCGGTTGTCCACGCTCCTATTGGAACTGAGGACATGGACGACGAGAAGTTAGCGGAGAACGCCGAGGCGGTTCTCA ACGCCATCATCAACAAGCTTGAGCGCGGCGAGAACCAGGTGAAGTCAGTGTACATCAAGACCACAATGGGACCGGCCGTT AAGGTTGAGAGGTGAGGGAG atggcccacgtagccgagtggaagaagaaagaagtggaagagcttaccaagatcatcaa gagccacccagtgattgccctagttgacgtggccggtgtccccgcttatccgctcagcaagatgcgtgacaaactccgcg ggaaggctctcctcagggtcagcaggaacaccctcatcgagctggccataaaaagggccgctcaggagctcaacaagcct gacctcgagaagctcgccgactacatcgagggcggtgctgccatactcgccaccgagatgaacccgttcaagctctacaa gctcctcgaggagagcaaaaccccagctcctgcaaagccaggggcagtcgttccaaaggacgttgttattcctgcaggac cgacttcccttgcgccgggtccgttagtcggtgagatgcaggcccttggaattccagcgaggattgagaaaggtaaggtc accatacagaaggattacaccgttctcaaggcaggggaagtcataaccgagcagctcgcgagaatcctcaacgcccttgg tattgagccccttgaagtcggcctcaacctgcttgcggcttacgaggatgacatcatttacactccggacgttctcgcga tagacgagcaggagtacatcaacatgctccagcaggcctacatgcacgctttcaacctgtcggttaacaccgcctatccg accaagcagaccatcgaggccatcatccagaaggcttatcttggagccaagaacgtcgcggtcgaggccggttacatcac acctgagaccgtcgaggacatccttggcagggcgatacgtgctttcctgctcatagcacagaacctgcccgaggagttgc tcgatgagaagaccaaagagcttttaaatgctcaagcccaagtggccgttgcggcccctcagccagctgaggagaaggtt gaggaggccgaggaggaagaggaagaagaggaggaagcaagcgaggaggaggccctcgctggactgggcgccctcttcgg c TGAAACTTTCAATTTCCCTCGTATCCTGTGGATCCATGTGAAATGGATGAAAAAATGAAGATGATTGGAGGTGTGAAA AGATGGAGTATGTGTATGCCGCTCTGCTGCTCCACGCCGCTGGTAAGGAGATAAACGAGGAGAACCTCAAGAAGGTGCTT GAGGCCGCCGGTGTTAGCCCAGATGAGGCCAGGATAAAAGCCCTCGTTGCCGCCCTTGAGGGTGTCAACATCGACGAGGT CATTGAGAAGGCCGCCATGCCGGTCGCCGCTCCGGTCGCGGTCGCCGCCGCTCCTGCCCCTGCAGAGGGCGGTGCCGAGG AGGCCCAGGAGGAAGAAGAGGAGGAAGAAGAGGAGGTCAGCGAGGAGGAGGCCCTCGCTGGTCTCGGTGCCCTCTTCGGC TGAACTCCTCCCATTTTCTTTACTTTCTGACCCTTCTCTTTGAGAGCGCTATTCTCCTGCTCCCCTGATAGTTTCCGCGG TAGGGCCTTTTTGCAGGTTCT