

>tg0513 ATPase of the AAA superfamily, putative

>tg0513 ATPase of the AAA superfamily, putative

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 492003 - 494313 (Additional range around tg0513 is :500nt.)

>Thermococcus gammatolerans EJ3 GAGGAGGCAAGTGAGGGCTACGAGCTGGAGTTCAACACGGTTCTCAACAAAAAGCGCCTCCTGCAGGTAGCGCCGATACT CGGCGAGGTGAGCGTTGAAGGGGACGTCGTAAGGGCTGGCGAAGTCGAGTTCTTCACCAGGACGAGGAAGGCCAAAGCTC CGGACGAAAGGGAGGCGGTCAGCGCCTACTACCTCGTTAAGAGGGCCTACGAGTGCGTTGGCTGCGGCGTCTGTGTCGGA AAGTGCCCGGAGGAAGCTTTGAGCATAGACGAGAAGAGCAAGAAGATAGTCGTCGACTGGAACCGCTGTACGCACTGCAG GGAGTGCATGGAGGTCTGCCCGCTGTTGAAGATTAAGAACCCGGAGGAAGGGAGCCAGCTCTGAGTGGCATGTTCTCGCT TCTCTTTGGATTTTGGTAAACTCGACTTTACAATTTTTGCGCAATTTGGTAAAGTATAGTTGACCAAAATCCTTAAATTT TGGAAAGTTGAGTTTTATAC atggcgaccatgatggaagctctcgaagaggttatagccgagtttcatgagttcggggt tccagaggccaaggagagggaactaaccctcccccttaacgttgacgttgcggtttctgtttacggccttcggaggacgg ggaagacccatctcctctatctggcaatgaggaaactaattgagaacggtctcccaatcaagcggattttttacgtaaac ttcgaagacgagaggctcgctggaatctccgccagagacctgtccacgatagttcagctctactacaagcacaaccccga tgctgatgttatgtacctcttcctcgacgaggttcaggtcgttgagggctgggagatgttcgtaaggcgtctgctcgaag ggaagagggcgagggtgttcataacgggctcgtcttcaaaactgctctctcgtgaaatagcgacctcgctccggggaaga accctgggctttcggctgtttccactctcgttccgcgagtttctgactttcaagggcttcgagctgaaaaagcccttaac ggagaggaaaaggggtatccttctgcgcctccttgaagagtacattgagtacggcggtttcccaggaatcgttgattact cgcctccgctgaagattagaaccctccaggagtatctcaacctgatagtttacagggacctcgttgagcgctatgggata gagaaagtctcggccctgaaagctctgatacggattttagtcagaaacttcgcgagaaagatctcaatcagaaagctcca ctcccttgtttcttcaaccggcactaagatcagcaggccgacgcttgcggagtatctaagttatcttgaggacgtcggct tcgtgctcccgctcaggaagtaccacccgagcgatgtcgagtctttgagaagtcagccgaagctctacattgcggacgtt ggccttgcaacggccctcggtgtgggcgacaccggttacaggattgagaacatcgttgccgttgagctcctgcggaggaa acactacttcgagccgaggcttgaggttcattattgggaagatggaagaggagaggtggacttcgtggtttccctcggcg ggaaggtgagggagctggtacaggttagctacgcccttgatgaaccacaaacccgtgagagggagcttagagcacttctc agggcatcgaagaccctgaactgccggaacttgacaatcataacgtgggaggaggaaggggttgaagaaattgatggaag gaggattcgcttcctcccgctttggcgctggctgattgagaggacaccttta TAAGCCCCCCGCCATTCTCCCCCTCTG GTGAGAGACATGGAGGAGTACTTCATCTGTCCCGAGTGCGGTAGCGATGACGTTGAGGTCATCAAGGAGCGCGGGAGGGA GCTGACCCTCCGCTGTAACGAGTGCGGCAACGTCTGGCACGTGACGCTTCCGAAGCTGGTCAGAGTTCCGCTCATAGTGA GCAAGCACGAGAGGAGCTTTAAGAGCGAGGCGGAGCTTCCCGAAGGAGAGGAGATTAGAGTTGGCGACATCGTCGAGACC GAGGAGGATGAGGTAAGAATTACCGGAATTGAGCTGGAAGGCGGGAAGAGGGTGAACAAGGCGAAGGTCGGCGAGATAGT AACGCTCTGGGGCGAGAGCCTGACCTACCCGAAGGTCATCAAGGTGTCGATCTATATGCCCAAAGGAATCACGCAGTCTT TCCGCGTCAAGGTTCCGAGGGATGAGGAGTTTGCGGTCGGAGAAGTCGTCGAGGTCGGGGGCTACACCTTCA