

>tg0526 Diphthamide synthesis DPH2 protein

>tg0526 Diphthamide synthesis DPH2 protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 500481 - 502503 (Additional range around tg0526 is :500nt.)

>Thermococcus gammatolerans EJ3 GGGCTTTCCAAGCTGCTGGTAGGCGAACTGAACTGCCCTGAGCCTTATTTCATCACTTACCTTGACCCTCTGGAGGGCAA CGACATCGTACCTGCTGAGGAACTCGCTGAGGGGAGTTATTATGATGCCTTTCCCGATCTTGGCCTCGATGACCATCCAG TCGTCTATGCTCTCGTTGTACCAGGCCACGATGGCAACGTGGATCCAGTAACCGGGGATTATGGCATTAAAAAGGTCCGG GCTGTGGCCATAAACGAGGTCTCCTGGCCTGACATCAGTCGGATACGGGTGCTGATACGTCCTGGTGTCCCAGAAGTAGT TCAGAAGATCGCCGGCGCTGACCTCTGGAACCGTCGCTCCGAGGAAGAGTAGGGCAACGAAGATTGCACCAAGTCTCTTC ATTTGATCACCCCCAATGGAGCGGAGAATGATGGAAAGGTCATTAATAAACCTTTCCAGATCATTTATAAACTCAACCTG GAACTTCTCGTGGTGGTGAG atgcacgaggttccgcatggcgagatactgaaggagttgaaaaaactgggcgcggagtg cgtcctaatccagtcaccagaggggttgaggagggaagccgaagagctcgcgggctttctcgaagagaatggtttaaccg ttatccttcacggcgagataaactacggggcctgtgaccccgccgattccgatgccagaaggctcggctgcgacgcctta attcacctcgggcacagttacatgcgcctgaaccttgaagttccgacgatcttcgttcccgcctttgcgaaggtcgaact cgttcccgcccttgaaaagaacattgaggagattcggaagcttggaaggaggatagcgctcgtaaccaccgcccagcacg ttcacaggcttgacgaagcgagggagttcttggagaagaacggcttcgaggtgctcatcggaaggggcgactcgagggtg agctggcccgggcaggtgcttgggtgcaacttctctagcgcgaaggtcgaggcagagggggttctcttcataggctcggg cctcttccatccgcttggggttgccctcgctaccaaaaagcccacccttgcgataaacccctactccggcgatgcaatct ggatggacgctgaagcggaaagactgataaggaagcgctgggcccagatagccaaggctatggacgcgaagagctttggg gtggttgtcagcaccaagaagggacagctccgcttagcggaagccaagcggattgttgagctccttcgagggcacggtag gaaagcgaggctcatagcgatggaccacataagctatccgaagcttgagggcttccccttcgacgcctacgtcgtcgttg cctgtcccagagttccaatagatgactacgagaactggcgcaagcccgttttgacgccgagagaagtcgagcccctccta ggcctgaagaaggagtacgagttcgatgagatacctggagttgagcggagggaggacgagcctttaggcgtttcgctcaa atta TGAAACTGATACTTCTTCTTTAGGCATCCAGTGAATACTATTGATATTTGTCATTTGTTTTTGTGGGAAGATAGT GCGGTTTGAGGAAACTCTACCATAAGAGTTATAAGTTTGAAATTCAAATGACGGGATGTCATGTTGGTCGATGATAAAAC TATCAAAGTGATAGAAGAATATCTACGTTCCTGGGAGATTAAAAAAGCCATCGAACTAGCTTTAAAAGACAATGTATACC TGTTGGCTCTCTTCAAGCTCCTACACGAGAGTGATGATACTCTCAAAATTCGGGCCCTAATAGCCTTGGAGGAGGTTTTA AAAGCGCTTCCCGACGTTAAACGGCTTATTCTTGTTGATAAGTTTCTCGACGATGTTATTAAGGTGCTGAAGAGTGATAA CGATGGCGTTTTAATTCATGCGATCAGGACAATTGGTAGGCTCATTGGGGGCATCCCCCTTCATCCAGAGACCTTCGTAA AACTGGCCCACGCTTTCAAAGATC