

>tg0534 Nicotinate-nucleotide-dimethylbenzimidazole (NaMN:DMB)phosphoribosyltransferase (cobT)

>tg0534 Nicotinate-nucleotide-dimethylbenzimidazole (NaMN:DMB)phosphoribosyltransferase (cobT)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 507965 - 509963 (Additional range around tg0534 is :500nt.)

>Thermococcus gammatolerans EJ3 CAATGTCGTAGTCCTTCAGGTTAATCTCGACTGGACTGCCGGCCCCTTCGATTATGACAAGGTCGTGCCTCTCCTTCAGC TCGTCTAAAACCTTCATCGCCTTCCTGAAGAGCTCCTCCTTCCGCGAGAGCATATAATCCTTGGCGGAAACGCTCCCAAT CGGCTTTCCCATGAAGATGACCTGGCTCCTCATGTTGCCCTCGGGTTTGAGTAGAATCGGGTTGAACCTGACGCTCGGCT TCTTCCTGCACGCTATCGCCTGCAGATACTGCGCCCTGCTTATCTCACCGCCCTCTATGCTCGGAGCCGAGTTCAGGCTC ATGTTCTGGCTCTTGAAGGGCACCACATCGTAGCCGAGGTTCGAGAAAATCCTGCATAAGGCCGTAACGAGGAGCGACTT GCCTGCTCCAGAGGACGTTCCAAGGACCATTAACGCTTTTCCCATCTCCAACCCCAAAGGCTATAAGCGGGACTGGATAA AAACTCCACGGTGGTTGGA atggagagcctcttccttctcgtcctgggcaacacggagataagcaccgtgccggggata agcgttgccggagcgacgccagagctgacgaagctgacgcccgttgccgatgccgaatacctcttccacgagaagcccct gacgattgacgtcattcctgtaacgcccgaaggccatccgacgccggccataatcaccaaggccgcgagggagctcgcga acttcccggttctcgtcgtcaggggtgggacgtatctggctccgctcgttccgcacgtccacatcagcgacgccgtcgga agggacttcaggaaggagcctgctttacccgagttcggcgatataatcaagcgcgccaagctcttcggtgaggagctaaa caagacgccgataaaggagctggtaatcggcgagtcgacgccgggaggaacgaccactgctcaggccgtcctctgggcgc tcggctacgaagcgagaaccagctcggcctcgcctgacaatccccagagcctgaaggagaaggtcatcgctgaggccttc gaaagggcgggaattgagaagggccagttgagggacaaccccctcgaagccctcaggcagttcggagacccgatgatggc gacggtaatcggcattgcgctcggctttaggagggacatcgttttggcaggtggaactcagatgctggcagtttcggcgc tcctaaaggccctcggcgaggatttaagcaggttcatgatagccacaaccaagtgggtcgccaacgacaagagcgcgacc ttcatcgagacagcgaaggaaatcgggattataagctacgccgccgatttggatttctcgaagagcgagttcaaggggct gagggactacgagcgcggttacgtcaaggagggtgttggagctggaggcgcgacgtggctggccgttaaggccggtttct cgccggaagacgttagcgaaaaagtggaggagctgtacagaaggctcatggagatgaaa TGAGCTCCCTGAGGAGTTCC ACCTCTATTCCAGCTTTTACGGCCGTCTCATACATCTTTTTGTCGTCGGTTACCAGTTTGGCGTTTGCCTTCTTCGCGCA GGCGAGGAAAAGAACATCAAAACCGCTGGCCCCAGTTTTTCTGCCCAGTTTCATCGCGTCTTCCATGAGGTAAACGTCGG AGTAGAAGATTGAGTAAGTTTCGAGGAACTCGACGCCAACGTCGACGTTCTGAGCTTTCTTCAGCAGTTCCTTGGCTTTC AGATGAACGGAAAGTTGCCGGTAGTAATATCATTGTGTTTTCGGCGCAACGGCGGTAGAAATCCCTTAACGAGGACGCTT GTGTCCAGCACTACGTCAATACTCGGACTCATAGTCTCTCTCCCTCATCTGGCGGATTATCTTCGTTATATCCTCCACGT CCTCTTCGACCTTCAGCTCCTCCTGAACAACTTTTTCTACCTCCTCAAGGGTAACCTTGCCCTTCTGGATCTCCTTTAAC