

>tg0565 D-isomer specific 2-hydroxyacid dehydrogenase

>tg0565 D-isomer specific 2-hydroxyacid dehydrogenase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 528988 - 530986 (Additional range around tg0565 is :500nt.)

>Thermococcus gammatolerans EJ3 GTACCGGAGGACTTCTGGGAGATCAGCCTCAAGATGCACGCTAGGTACGGCGAGCTCTTTCCGGACGCTGTTGAGACGAT AAAAGCCCTCAAGGGACTCGGACTGCACGTTGGAATCGTAACTGACTCGGACAACGACTACATAGAGCACCACCTGGGAG CCCTCGGCATCTACGAGCTCTTCGACAGCATAACGACGAGCGAGGAGGCAGGCTTTTACAAGCCCCATCCAAGGCCGTTT CAGCTCGCCCTCGAAAAAGCTGGGGTTAAACCGGAGGAAGCGCTCTATATTGGGGATAACCCAGCAAAAGACTGTGTTGG AGCCAAAAACGTGGGGATGCTCAGTGCTCTCCTAGATCCAAGCGGCGAGAGGAGGGAGTTATGGGAAAACTGTGACTTCG TTATTTCCAGTTTAAAGGACGTCATAGAGATCGTTAAAGGACTCAAAGGCTGACCAAAACTATTTTTAGCTTTTCGATAA AGATCTTAAAGGTGATAGC atgagacccaaggtggccgtcctcttcaagatgaagagcaaaccccttgaggaactcaag aaatgggcggacgttgacgtaatcctctatccgagcgttgaggagcttaaaaaggtcatcggaaagtacgacgggctgat agtttccccgctcaaccccgttccaggtgaagtcctcgagagggccgggaggctgaaggtcataagctgtcattcagcgg gctacgaccacgttgacgtcgagaccgcaacgagaaagggaatctacgtcaccaaagtggccggtgttctcagcgaggca gtggcagagttcgccgttggcctaaccatagcacttctccgtaagatagcttacgccgacaggttcattcgctctggaaa gtgggactcccacaggacggtctggagcggtttcaagggcatcgagacggtttacggcaaaaccgttggaatcctcggca tgggggcaataggaaaggccatagcgaggagaatgaaggccatgggaactgaaatcctctactggtcgcgctcgcggaag cccgatatcgaggaggaagttggcgcgaggtaccttccccttgacgacgtgctgaaggagagcgacattgtagtcctcgc cctcccagcgacgaaggaaacctaccacatcatcaacgaggagaggctgaagctccttgagggtaagtacctggtgaaca tcgggcgcggaacgctggtggacgagaaggcccttgttaaagccctcaaagagagaaggctgaagggctacgcgaccgac gtcttcgagaacgaacccgttcgggagcacgagcttttcgactacgagtgggagactgtcctaacaccccactacgcggg cctctcgaaggaagcgatgaaggacatgggctttcaggcggttagaaacctcttagcagttctgcgcggtgaagttccgg agacgctcgttaaccgtgaagtcctgaaggttcgtccgcccgaggaagtaaagatgctc TGAGGTGGTTTAAATGGATT GGAGGAAAAGGCTGAAGGGCCTTCTCGAACCGTACGGCGAAATTACTGAAACCGATAAGGGGTTAATCTTTGAGTTCGGC GACGATGAGGGAGACTTCTCCGACAGGCTCGCCTTCATCATTGAGAAACCTGAGGAGTGGCCGCTGGTGGAAGTTGCGGT AAAGGCGATAGCGGATTTAACCGACCACGACGTCCCTGGGAGGAACGTCTTTGCCTTCGGCTTCGAGCCCGACTTTGGGG GAACGCTCCTCAGGCTTCGACTCTTCGAAGGAAAGCCTGGAGAGGGACCGGTAATCGGGGATGTTCCCGAGAAAGTCGTT AAGATAGCGGAGCGCAACGGCATCAAATACCAGCGCGTGGACGGGGAGGGAATCGGCCTTCCGAAGGACTTCACGGAGGA GGACCTTGAGGCCCTGGTAAAGCTCGTGGAGGCCGTTGCCTTTGAATGGTAAGGCTTTAAAACACCGATGACCAAGAGTA