

>tg0579 hypothetical protein TGAM_0579

>tg0579 hypothetical protein TGAM_0579

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 543452 - 546098 (Additional range around tg0579 is :500nt.)

>Thermococcus gammatolerans EJ3 GATGCCGTAGTCTATCTTGACCTCCTTCTCGAATTCCTCCAGGATTATGTCCTCCATCGTTTCCTTGGGCATGTCATCTG GCAGAAGGGCGACTATGGGAACCTCCTTGTTGTTGGTTCTTATAACGTAGATGGCCTTCTTTACCGCCTCGAGGTTTCTG GTGGTTATCACGACGACGTTGGCCCTGTCAACGCCGGCCTTCAGAAGGGTCGCTGTGTACGAAAAATCCCCCTGAACAAC GTTGAAACCGCTCTCCTCGAGGGATTTCGCGCGGAGCTCGTCCTTTTCCACTATTGTTATTTCAAACTCTCCCTTGAGTG CTTCCGCGATCTGCCTGCCTATGCTCCCCCCACCGAGGATCAGGATGCGCATGATCATCACCTATGAGCAACAACGTTTA AATAGATACGTTCCCATAGATTGGGAGGGATGCACCGCCCGTATTATCTTGGTTGGGGATATATATAGCTGTCGCCCATA AACAATCAGATGGTGAGATT atgaagctgccggacacaaggcccctgaaagaaaacgtcgttgtaatatctccctcgga tttagctcaagaggtcaagagcgtagcttcccagtctgggggagcgttcctgaagatctttggcaagaaggacaactcca agtactaccttacaatactcttcgacagaaccaaggttctggccgccgaggggcaggacttggaatcaggggctcaggta atcggtgaagaggctataaacctcttccggaagctgatgggcaacccgatggtcgtcgacgtctattccctcgatgagat cggtgtcaagatctcgatagccgagaaccttgacgtatactccaaaactcccaagataacgatagaggaactctttgggg gaagggccccagcaagggtcgaaaagcccaagcccgtgccaaaacctgctgaaaaaccagttgaaaagcccgctgaaaag cctgtgaaggctcgggaaaagcccaagccaaagcccggcgagatcgagatcgttatcgagatccccggcggggacgtcct cgaggaggccctgaaggagtacacgaagcacttgatctcagaggccaagcggataagaacgctccagataaacaaggtcg tctactccggtgagctcaccgagggcgtcgtctacctcaatgtccacatatacggccacagtgaaggacagatgagggag gtagccgaaaagagaatgctccacgccataagcaaatacgcccccgttatactcagaatggcggatataaagcccattct caaggagataaaggtcatcctcgacggcaaggaggtggccccacaggagatcgttgaaagggacaagaagaagatcggga aagttgaccgggagggcaggcttacccttgccgttcttgaggacgtctggccttacttcagcgcaatgatgagaactgtc gttaacgagatagaacgccaaggaatagctgttaaggcggccacttttgacgttcctggcaggaaggaattcgaagtgaa cgcgaagctcgcagttgagacttccctctcagaggatcaggcaaggaagataataagggacatcatcacaaagcacacga aggaactcggtaggacgctgaagaggtacatgacggttcacaacgttgaggtggaattcataaagaaggccgagactgtg aaaccatctgcaaaggtgccaacaacgggtaaagctgcggagatcctccagaagaaggcggagctggagaaggaggtcga gaagctactccagcaggcgggtgttgaggaactagcctttttgacggaagaaaagaagcgtgaaagcgaaaaggctctgc tgaggagcaggatagagccggcaatggaggagctcaagaaccggctccacaccgagctcaagctcattccgagggttact tttaagtggctcaagctcaactgggacgccaaggggacgacggtttacgtggacattgaagcatcgttcatgaaggagga gataggcggtcttttcggatccttttcgggcgttgatgagggcaggatcaagcaggacgtcagggaaaccatactccgcg tgatcagggatatacagaaagagtacggcatcaagatcagtctcaacaagttcaacgttatcgttagg TGATCTTAAAA TTTTTTAAGTTTTCCTAATTTCTCAATCCGGGTGCTGGTAATGCAGGTCATCGGCTACGTGCTCATCATCATAGCCCTCG GCAGGTTTCTGGCGGAGCTCTTCGAGAGGATAGGTTATCCCGGAATAGTCGGTGAGATAACGGCAGGTTTGCTCCTGGGT TACTTTCTCAGAGACGTTCCGGCGGGAGAGATGAACCTTCTGGCCGAGTTTGGGATATTCTTCCTTATGATCCTCGCGGG CCTTGAAATAACACCTGATGAGCTCCGCATGGGTGGCAGGGAGGCTCTCCCGGTTTATCTCGTGACCCTCGCCGTGATGT TCTTCGTCACCCTGCCGTTTACTAATTACTCCATCTCAACTGGAAACATCCTTGCGGCTTCGATACTGGCCGTTGCCAGC GCTCCGATCGTCGTTCGGATAAAGCGTTTCTTCGGGGAGGAATACCTCCATGTGGCCCTTTCGTACGCAATAATAAGCGA GGTCGTCA