

>tg0588 Isoleucyl-tRNA synthetase (ileS)

>tg0588 Isoleucyl-tRNA synthetase (ileS)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 551326 - 555523 (Additional range around tg0588 is :500nt.)

>Thermococcus gammatolerans EJ3 CGGCGGATACTCAAAGCCCGGCCCGTGACCTATGGTTATCACCCCATCGGGACTAACAATTGCGCAGACCTGAACGTCGA GATAGCCGGTCAACGTTCCCGGGAAGGGGTAGATTCCCGCCTCTATTCCGACGCCGAGATCTGCTCCTGTCTTCTCCAAT GCTTGCTTAGCCCTGTTTATAGCACCCCTTGCTATCTCCTCGATTCCAATCGGCTGGTCTGAAACGCCGCTGTCCACTTC AACGCCGACCACCTCAACGTCGCCATAAATCCTCCGCATCACGTTCTCAACGGCTTTAACCTTCGTGGGATTAGTTGAGC CAACTGCAATCCTCATGATACCCCCCATTTCAGAGCCTCCAAAAACCTTATAAATAAAATCCCCAACTTTGGCCCGATAC CCATGAGGGGGGAGTGTTTTATCCTTCGCTTCGCCCGTTTCGAGGCTTAAAGCCCCCTGTTCTGGGTTAGTCTTAGCTAT CACTTCTGGAGGGTTCTGGG atgattaaggagccagagtttagggaatacaacccgggcaagctggaggagaagataga ggccttttggaaggagaacaacacctacaagaaggtcaaggccagcagggcgaacggcccgaagtactacttcctcgacg gaccgccgtacgtgagcggtgcgatacacctcggaacggcctggaacaagataatcaaggacatgataatccgcttcagg accatgcagggctacaacgttcgcagacagccgggcttcgacatgcacggcctgccgatagaggtcaaggtcgagcaggc cctcgggctcaaaaccaagaaggacatagagaccgagataggcgtcgacaacttcatcaagaagtgcaaggagttcgccc tcaacaacctgaagataatgaccgagcagttcaagatgctcggcatctggatggactgggacaacccctacatgaccata aagaacgagtacatcgaatcgggctggttcacgctcaagaaggcctgggagaagggcctcctcgagaaggacaagcgcgt cctccactggtgcccgcgctgtgaaacagctctggccgagcacgaggtccgcggcgagtacaaggtcaggaaggacccga gcatctacgtcaagttcccggttgagggcagggagaacgagtacctcctcatctggactaccacgccctggacgctccct gccaacctggccgttactgttcaccccgagtacgactacgccaaagtaaaggtcgagaccgaggacggcgaggagtactg gataatcgcgaaggccctcgtcgagcgcgttcttgctgaggtcggggccaagggagaggtagtcgaggagttcaaaggag aggagcttgaagggctccgctacgtccacgttctcatggacgagtatccgaggcagatggagttccgcgagaagtacgag tgggctcaccgcgtaatcctcggcgagcacgtgacgcttgaggacggtaccggacttgttcacaccgctcctggacacgg tgaggaggacttcgaggtcgggcagaagtacggtctgcctgtttacagcccggtcgacgaccagggtaggtacacagagg gcaggtggaagggcgtctacgtcaaggacgcagacccggagataatcgagcacctcaaggagaagggctacctcgtgaag gcgggaacgatagagcacaagtacccgcactgctggcgctgtaagaccccgcttatcttccgcgccactgaccagtggtt cctcaaggtcagcaaggtgaaggacaagataatcaaggagaacgacgagaaggttacgtggtatcccgagtgggtcaaag taagatacgacaacggcgtcatgaactcgggcgactgggtcataagcaggcagaggtactggggaataccgctcccgata tggcaggccgaggacggcgagatatacgtcgttggctctttcaaggagctggtcgagcttgccgtcgcgatagaggtgga cggcgagcgcattgaactcccagaggattacaacgagaagctcagggtcatagaggagaagcttggcccagaagatttgc acaggccctacgtcgatgccttcatcataaaggtcaacggcaaggaaatgaaacgcgtcaaggacgtcgttgacgtctgg ttcgacagcggaatagcgagctgggcgtcgctcgactacccacgcaacaaggagctctttgagaagctctggccggccga cttcatagtcgagggcgaagaccaggtcaccaagtggttctactcccagcaggccgcgagcgtcatagccttcgacaccg tgccttacagagccgttgccatgcacggctacgtcctcgacgagaagggagacaagatgagcaagagcctcggcaacatc ataaggcccgaggaggtcgtccagaaggagggaagggacccgttccgcttctacatgctctgggccaccaacccctggga gaacctccgcttcagctggaagggcctggctcaggttaagagaatgctcaacatactctggaacgtctacgtgctcagcg caacctacatgagcctcgacaacttcgacccgaccaagctcaagcccgaggagtttccgttccgcgaggaggacaggtgg atactcagcagggtcaacgggctcataaaggacgtcgaagagggtatagagaccttcaggctgacgaaagcaacgagagc catctacaccttcgtcgtcgaggacctgagcaggtggtacatcagactaatcaggaagcgcatgtgggtcgagggagatg acccagacaagttagcggcctactacaccgtctggaaggtcttcgacgtcctcctcagattgatggccccgttcacgccc tacatagccgaggagatataccagaacatgctcaggcctttcctcggagtcgagagcgtccacatgctcgactggccaaa gcctgacgagaaagccatagacgaggagcttgagcgcgagatggaggcagtaaggaagatagtcgaggccggctcttcag cgaggcagagggccaagataaagctccgctacccggtcaggaggataatagtggagaccgaagatgagaccgtcaagaag gccgttgagaggctcaacagaatcctgcgcgaccagctcaacgccaaggaggtcgtcgtcggaaaggtcgagcgcgagct cgtcatcaagcccaacttcgccaaggtcgggccggagttcaagggcgacgccaagctcgtgatagcctggataaacgagc acggaagggaactctacgaggccggcgagatggacgttaaactcgaaggaaagaccttccacctcacgagggagcatctg acaatcgaggagaaactgccggacttctttgtcgccgaggactttgagggtggaagggtcttcgtggacaagaccctcac gagggagctcctcgccgagggactcgccagggagttcgtcaggaggatacaggagatgcgcaagcgccttgatttggacg tgaacgacagaatcgttgtcaccatagagaccaccgacgagaaccgcgaactgctcagcgagaacctcgactacataaag aaggagaccagggcgaccgagataatcttcggcaaggccaagggctacgtcgtcgagtggcccgaggttcaggcgaagat agggattgagaaggtggag TGAGATCAACTGCTTTCTCCTTTTATTTACCACAAATATTTATAGTCGAATCGGACTTCA ACGACACCATACAGAGTAGTATGATATAATTAATTCATCAATGGAACGTCTCCAAGGGATAATGGCTTTGGAGGATATTC CAACAGAGAAAGTACAAGATAAAGCTTTTAATGTATTAGCAAACTAATAAGTAACTGTATGTATGACAAAATTGTAGCGT ATTTCGGGAAGTTCTTAAATAGTTTAGATTGTATATTACAATCTCACGAGAAAGAATTTTGGAGAGATTATACACTAGAA AAGCATAATCAACTAAATTATTCTAAACTCGAATATTCATTGTTTTTAACAATAGGTATTCTCGGATCTTTAATTCTGAA CTCGCTCTCAGGAAATCACACAGATTCATTAAGCACTTTGGATAAAATACTTGTAAATGCCAAGTATATTTGGTTAGCAT ATTCTCCAATTGCAGCTCTATCAAGCTATGGCCTCCTTA