

>tg0595 Radical-activating enzyme, pyruvate formate-lyase related

>tg0595 Radical-activating enzyme, pyruvate formate-lyase related

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 560483 - 562565 (Additional range around tg0595 is :500nt.)

>Thermococcus gammatolerans EJ3 AAGGCCTGCAGGCGCTACCTGCTCGTTTACACCGGTGCTGTAGACAAGGCGATGCCCTTCCTGCTCTAGCGCCAGCCGAA CTCCGCTAGAAACTTCCTCTTCAGCCTTTTTATCGTCCCCGAAACTCCGAGCGTCCGAAAGATTGCCTTCGAGCCGTTTA TCTCTGTAACGAGCGTCAGGGCAAAGCGCAGTTCTTCGACGTGCTTCCTGTCAACCCTGACGATTCCCGTCTGGCTCTTC TCGTCGAAGCGTATGAACCAGGGCTTTGCTTTAGCCGAGCCGAGGACTCCGAGGGTTGAGAGGCTCGCCTCCCATATCGC CTTCTTAACCTCATCCTTCCGGAAGGGCCTCTCCCCAATCAGCTGGAAGGCTATGTAGCGGTGCTTCTCGCGGAGCGTGG GGGGCAGATACTTCGGCTTCTCCCTCATAGGCATCGGACAACTTTGCCCGCCAACGTTTTTAAGGCCTGCCCTCTGGTTA GGGTTAGCGGGGTGGAAGA atggtctgggagacgccttacttttcgtacgccgtgagagagctcccgaagggctgtcag ctctgcgttaggggtgaaaagctcgtcctcttcacgaccggaatctgcccgagaaactgcttctactgcccgctgagccc ttggaggagggaagatgttgtttatgccaacgagaggcccgttaagagcgttgatgatatcattgaggaggccctgattc aggaagccaagggagctggagttacaggtggggatccgctggcgaggctcgacagaaccgttagctacatccgcgccctc aaggaggcctttggaaggaagttccacgttcacctctacaccaccggcgctctggccacgaagaagaaccttgagaagct ctacgatgtgggattagatgagatacgctttcatccagacctcttcaacccgaactcgaagctcttcaaggtggaaatcg agaacataaagaatgcctttgacttcgactgggacatcggcggcgagattccctcgattccgggccagtttgagaggatg aagtggtacgccgagtttctggataggttaggcgcgaagttcctcaacgtgaacgagctggagttcagcgaggttaccct taaaaccatgctcgacatgggctacgagccggtaagcgacgagagttccgccattaggggctcgctcgagctaggtctaa agcttctcgagtggggtgagaagaacacttccctgagctatcacctctgcaccgcgaagcttaaagatgccgtccagctc aggaataggctcaggagaatggcgaggaaggtggctaaaccttacatggaggtaaccgaggacggaacgctccgctttgg catcgctgaatacgacgacctcgacgagctctacgagttcctcgttgaagaagtcgaagttccggcggagtggctctaca taaacagggagaagggcaggattgagatgcctgaggaggtggctttagagctggccgaggccatcgaaggtgacgtgagg ttcttcatcgtggaggagtatcctaccttcgacaggatggaagttgagaggatcccgctgccc TAGGGCCGCTCATTGT GAAATCGAAACGGTTATATAAAAGCCACGAATTCATAGCAACAGGTGATGGTTTTGAGCTTTGAGGGCTCGCTCGAAAAG CTGCTCACAATTCTCGAGTTCGACCTCTCAAATCCGTTTAAGGACGCTGAAAAGGTTCTCTGCATAGAGCCCCATCCGGA CGACTGTGTAATCGGGATGGGTGGAACAATAAAGAAATTGACCGAGCGGGGAGTTAAGGTCGTCTACCTCTGCCTCACCG ACGGCTCAATGGGGACGTACGATGAAAGCGTGTCCCCCCATGAACTAGCCCTCATAAGGCGAAGAGAGGAAGAGAAAAGC GCCAGAATGCTCGGCGTTGAGAGGATAATCTGGCTCGATTACAGGGATACGGAGCTTCCATACAACATCGAGGCGAGGAA CAATATAATCAAAGTCATCAGACAAGAGAAGCCTGACCTCGTCCTCGCTCCGGATCCCTGGCTACCCTACGAGGCCCATC CAGA