

>tg0602 Maltose transport system permease protein (malG)

>tg0602 Maltose transport system permease protein (malG)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 568769 - 571109 (Additional range around tg0602 is :500nt.)

>Thermococcus gammatolerans EJ3 GATCCGATATTCGGGCCCGTTAACATAATCCTCCGCGATTTTGGAGTTTCAAATCCCCCTGACTGGATAAACAACGCGAC CTACGGCTTCATAGCCCTCAACATCATCGAGGTCTGGCTGGCTTACCCCTTCATGATGACGGTGATAACCTCGGCCCTTC AATCGGTTCCGGATATACTGGTTGAGGCGGCCATAATAGACGGCGCCAACTACTGGCAGAGGCTCACCAAGGTTGTTCTG CCAATCGTGAGCAAGCCGATAGCCTTCGCGACCATACTAACGAGCGCCGCGAGCTTCCAGTACTTCCTTGTTCCCTTCCT CTACAACGGCTCCCTCTTTGAGGACAGGTTCCTGCTCCTCTACGGTTACCGGAAGGCATTTGGGGCGTCGGTTCCCCACT ACGGCAGGGCTGCTGCCGTTCTCTTCATAGCCACGCTGATCCTGGCGGTTTACATGTACATAAGCATGAAGATAACCAAA CTGCAGGAGGGGGCGAGCTG atgttcgatttccacttcaggaacagaagggagctttttaaggccctcctcgcaacggc cctggctataatcgtcatgggtataattctctttcccgtgtattatgtgttcacggtctcacttaagccccaaggaacgc tcgcctcgacgtctctcgacctcttaccggaccagatgacactccagaactacaaagaggtaatgtttggccacaaggat gcgaccgtaaagaccaaggtcttcaacataacttcctcaaggggcaagctcatcggaacggaatacaccatagagtacat ggacggcgtgctctacgggaagtacagaggtctgccccccaggttcaatctcaagtatatctcgcacctaaaggttgaag gggctaacagaagcgtcgaaaacggccaagtgcagtacctcggaggcaagttcgtctctatggatgcgaagagaattatg gtctccttagcttcccttaggagggagtacctatatctcacggccaaggaagtcaggataaccgtgaacggcaagacggg cattcccctcgatggcttcaccaaggtcggtaacaacacctacgttggcagggacgtcaccctcaaaattccggacagag ttaggcttgactccgaggagggacactttgaggccagggacttctactacgtcttcatcaaccagatcggcggcggtttc tttggctatctcaagagaagcctgatcatagcgtccctgacagtcgtgctaacgctactcttcgcggttccagccgctta cgccttttcgaggctcaagttcttcggcagggagcacatcctgtacttttacctgatgttcacgcaggtttccggaggcc ttgggatagccggcttggtggccctctacggaatgctcgttaagctcgacctaaccaacaacatctacgtcctccccctc atctatgccgccggtggagttcccttcaacacgtggctcctcaagagctacctcgactccataagtccggacttcgacga ggccgcgctggtggacggtgcaaactacctccagataatctggcacgtgctactgccgatggccctgcccggaatagcta ccgttgccatctttgcattcataggcggctggaccgagctcattcttgcaagccttcttatcgacaacgaaagcaaatac ccgctaacggtgtggctttacagtatgctcaacgatctcaggaacgtgtcgtggaaccagttctccgcggcggcactgct cttcgcgctccccgtgttcataatgttcctgctggcccagaactacatcaagagtggcttaacagttgggggtctcaagg aa TGATTTCGTTTTTTACGGCTTCGTATTCGGAGGTGTTGTGAGATGGTACGGTGGAATAGAAAGCTTGCCCTTTCCCT GCTCCTGATCGGGGTTATGCTCGTGAGTGCGTTCGCTGTAAACCTGGGCGGTGCTAACGAGACCACTCCAAAGCCCCTGA ACGTTATCATCGTCTGGCATCAGCACCAGCCCTTCTACTACGATCCAGTCCTCAACGTTTACACGAGGCCATGGGTAAGG TTGCATGCCGCCAACGACTACTGGAAGATGGCCCACTACCTGAGCGAGTATCCAGAAGTGCACGCCACAATCGACCTTTC CGGTTCCCTCATAGCTCAGATAGTGGACTACATGAACGGCCGGGAGGACACCCTTCAGCTCATCAGCTACAAGATCGCGA ACGGCGCTCCACTGAGCCTCGACGAAAAATGGCAGGTTCTCCAAGTCCCGGGTGGATTCTTCGACCACACGATCCCCTGG AACGGCGAGCCGGTAACCGATA