

>tg0608 Acetylornithine deacetylase or succinyl-diaminopimelate desuccinylase (DapE/ArgE)

>tg0608 Acetylornithine deacetylase or succinyl-diaminopimelate desuccinylase (DapE/ArgE)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 578102 - 580415 (Additional range around tg0608 is :500nt.)

>Thermococcus gammatolerans EJ3 TTGTCGGGTCGGAGTGCTGGCTCGGGGTTATCAGGAACTCCTCCTCGCCTATCGCTATCTTGTTGCCCGGCTCTGGCGTG TGGACGCTTTCGAGGACTTCTATGTGATACTTGCTTATCGCAGGTGTATGAGTCTCGTCGCCGTAGACGACGCTCTTCGA AGCTATGAGCACTCCCCTCTTCTTGAGCGCGCCACCGGTCATGGCCTCGACCATGACCTCGAGGTCGTTGCAGTGGTCAA CGTGCCTGTGGGAGACGAAGATGGCGTCTAACCTTCTCGGGTCGAGCTTGTAGCGCCAGCTTCTAACCAAAGCACCCGGC CCCGGGTCGACGTAGACGTTCCTGCTCGCCCTTATGTGGAATCCCCCAGTGGAGCGGAACTGAGTTATTGTGATGAACCT CCCGCCCCCGCTCCCGAGGAAGGTTATCTCTATCACTCCCTCACCTCCGTATCCTCTGCAGACGGTAGGCTTTAGGCGGT GGGGTATATAAGGTGTTTGG atggccgaaagcagtttaagctccggggagaagtgggggttggtgattcggatgactca gcttgggaaggtcttgaaggaagttgaaggcctgagagacgagatgataaagacgctcgtcgagctgattaagattccgg ccataagccccgactacggtggtgagggcgaatacgacaaggcccagaagttgcttgagattatcagagactggcccttc gacaaggtcgaggtctacaacgcgcccgacaagagggccaagaacggggtcaggccgaacatattggcctattactacgg cgagaaaggcgaggaaagcgagagactctggattctcacccacctcgacgtcgttccgcccggggacctgagcaagtgga ccgttaccgagccatttaaaccgctcgtcaaggacggcaaggtctacgggcgcggaagcgaggacaacgggcagagtttg gttgcttcgctttacgcggtgaaggccatgatgaacctcgggataaggccgaagaggacggttattttggccttcgtcag cgacgaggaaaccgggagcaagtacggaatcgaatggttgatgagggaacacccagagctcttcagggaagatgacctcg ttctcgtccccgacggtggaaacgaggacggaacgttcatagaagtcgctgaaaagggaatcctctggttcaagctaagg gtcagggggcagcaggtgcacgcgagcatgccggacaagggcctgaacgcacaccgcgttgcacttgatttggcctacaa cctcgacaaaaagcttcacgagaagtacagcgagagggacgagctcttcgagccagctgagagcaccttcgagccaacga tgggaggaaacccagcagacagccccaacataatccctggagagcacgaggtcgttttcgactgcagggttctgccaagg tacagcctcgacgatatcctcaaggacgtcgagggcgtcgtggaagaagttaaggagaggcacaggaaggagcttgacgg gaaggttctcccagaaatcgaggtggagattcttcagagggcagacccggccccgccgaccgacccggagggcgagatag tgaaactcctgaaggaggcgataaaagaactccgcggaaaggaagccaaggtcggtggaataggcggtggaacctttgcg gcgttcttcaggaggaaggggattcccgccgttgtgtgggcgacgctcgacgagatggcacaccagcccaacgagtacgc gaagattgacaacatggtcgaggacgcgaaggttatggctgctttggcgcttctc TGACTTTTCTCTTCTTACATTTCA AGCCTCTTTGAAGCCGTCGGCAGGTATTTATAATCCCGCGGACAACCGTACATCGGTGGAGATCATGAGATGGGTGGTTC CCCTTCTTATCCTAATCGTCCTCGTTTCTGGATGTGTAAGTGATGTGGACAACGCTCGTTTCGAGAGTTCAAGCTCCTCC TCAACTCAGGAGACGACCCCTAACGCTGGAAATTCTGAGTGGAAAAACCCTGTTGTGGGGGGTATGAACTCTTTCGCCAT TGAGCTCTATAAAAAGCTGGGAGAAAACAACGGCAACGTCTTTTTCTCTCCCTACAGCATCGAAACGGCCCTCACAATAG CCTATGAAGGTGCAAGAGGGGCTACGAGGGATGAAATGGGGAACGTTCTCCAGCTTCCCGGGGACAATGAGACCCGCTGG AAGGGCTTTAGAGGCCTCATTCTATCACTGGAAAGCAATGAGAGCTCACCCTTCGTTCTCAGGAGCGCCAACGCC